ID: 916275979

View in Genome Browser
Species Human (GRCh38)
Location 1:162993774-162993796
Sequence CGGAAAGAAACTGGGATGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916275979_916275984 16 Left 916275979 1:162993774-162993796 CCAAACATCCCAGTTTCTTTCCG No data
Right 916275984 1:162993813-162993835 ATCTCCCCCTCAAAGAGCTTAGG No data
916275979_916275986 18 Left 916275979 1:162993774-162993796 CCAAACATCCCAGTTTCTTTCCG No data
Right 916275986 1:162993815-162993837 CTCCCCCTCAAAGAGCTTAGGGG No data
916275979_916275985 17 Left 916275979 1:162993774-162993796 CCAAACATCCCAGTTTCTTTCCG No data
Right 916275985 1:162993814-162993836 TCTCCCCCTCAAAGAGCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916275979 Original CRISPR CGGAAAGAAACTGGGATGTT TGG (reversed) Intergenic
No off target data available for this crispr