ID: 916275980

View in Genome Browser
Species Human (GRCh38)
Location 1:162993782-162993804
Sequence TTTTATTACGGAAAGAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916275980_916275992 29 Left 916275980 1:162993782-162993804 CCCAGTTTCTTTCCGTAATAAAA No data
Right 916275992 1:162993834-162993856 GGGGAGAAACAGCTTAGGAATGG No data
916275980_916275993 30 Left 916275980 1:162993782-162993804 CCCAGTTTCTTTCCGTAATAAAA No data
Right 916275993 1:162993835-162993857 GGGAGAAACAGCTTAGGAATGGG No data
916275980_916275986 10 Left 916275980 1:162993782-162993804 CCCAGTTTCTTTCCGTAATAAAA No data
Right 916275986 1:162993815-162993837 CTCCCCCTCAAAGAGCTTAGGGG No data
916275980_916275985 9 Left 916275980 1:162993782-162993804 CCCAGTTTCTTTCCGTAATAAAA No data
Right 916275985 1:162993814-162993836 TCTCCCCCTCAAAGAGCTTAGGG No data
916275980_916275984 8 Left 916275980 1:162993782-162993804 CCCAGTTTCTTTCCGTAATAAAA No data
Right 916275984 1:162993813-162993835 ATCTCCCCCTCAAAGAGCTTAGG No data
916275980_916275991 24 Left 916275980 1:162993782-162993804 CCCAGTTTCTTTCCGTAATAAAA No data
Right 916275991 1:162993829-162993851 GCTTAGGGGAGAAACAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916275980 Original CRISPR TTTTATTACGGAAAGAAACT GGG (reversed) Intergenic
No off target data available for this crispr