ID: 916275981

View in Genome Browser
Species Human (GRCh38)
Location 1:162993783-162993805
Sequence CTTTTATTACGGAAAGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916275981_916275993 29 Left 916275981 1:162993783-162993805 CCAGTTTCTTTCCGTAATAAAAG No data
Right 916275993 1:162993835-162993857 GGGAGAAACAGCTTAGGAATGGG No data
916275981_916275986 9 Left 916275981 1:162993783-162993805 CCAGTTTCTTTCCGTAATAAAAG No data
Right 916275986 1:162993815-162993837 CTCCCCCTCAAAGAGCTTAGGGG No data
916275981_916275994 30 Left 916275981 1:162993783-162993805 CCAGTTTCTTTCCGTAATAAAAG No data
Right 916275994 1:162993836-162993858 GGAGAAACAGCTTAGGAATGGGG No data
916275981_916275991 23 Left 916275981 1:162993783-162993805 CCAGTTTCTTTCCGTAATAAAAG No data
Right 916275991 1:162993829-162993851 GCTTAGGGGAGAAACAGCTTAGG No data
916275981_916275985 8 Left 916275981 1:162993783-162993805 CCAGTTTCTTTCCGTAATAAAAG No data
Right 916275985 1:162993814-162993836 TCTCCCCCTCAAAGAGCTTAGGG No data
916275981_916275992 28 Left 916275981 1:162993783-162993805 CCAGTTTCTTTCCGTAATAAAAG No data
Right 916275992 1:162993834-162993856 GGGGAGAAACAGCTTAGGAATGG No data
916275981_916275984 7 Left 916275981 1:162993783-162993805 CCAGTTTCTTTCCGTAATAAAAG No data
Right 916275984 1:162993813-162993835 ATCTCCCCCTCAAAGAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916275981 Original CRISPR CTTTTATTACGGAAAGAAAC TGG (reversed) Intergenic
No off target data available for this crispr