ID: 916275983

View in Genome Browser
Species Human (GRCh38)
Location 1:162993794-162993816
Sequence AGATCAGATACCTTTTATTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916275983_916275995 20 Left 916275983 1:162993794-162993816 CCGTAATAAAAGGTATCTGATCT No data
Right 916275995 1:162993837-162993859 GAGAAACAGCTTAGGAATGGGGG No data
916275983_916275993 18 Left 916275983 1:162993794-162993816 CCGTAATAAAAGGTATCTGATCT No data
Right 916275993 1:162993835-162993857 GGGAGAAACAGCTTAGGAATGGG No data
916275983_916275992 17 Left 916275983 1:162993794-162993816 CCGTAATAAAAGGTATCTGATCT No data
Right 916275992 1:162993834-162993856 GGGGAGAAACAGCTTAGGAATGG No data
916275983_916275994 19 Left 916275983 1:162993794-162993816 CCGTAATAAAAGGTATCTGATCT No data
Right 916275994 1:162993836-162993858 GGAGAAACAGCTTAGGAATGGGG No data
916275983_916275985 -3 Left 916275983 1:162993794-162993816 CCGTAATAAAAGGTATCTGATCT No data
Right 916275985 1:162993814-162993836 TCTCCCCCTCAAAGAGCTTAGGG No data
916275983_916275986 -2 Left 916275983 1:162993794-162993816 CCGTAATAAAAGGTATCTGATCT No data
Right 916275986 1:162993815-162993837 CTCCCCCTCAAAGAGCTTAGGGG No data
916275983_916275984 -4 Left 916275983 1:162993794-162993816 CCGTAATAAAAGGTATCTGATCT No data
Right 916275984 1:162993813-162993835 ATCTCCCCCTCAAAGAGCTTAGG No data
916275983_916275991 12 Left 916275983 1:162993794-162993816 CCGTAATAAAAGGTATCTGATCT No data
Right 916275991 1:162993829-162993851 GCTTAGGGGAGAAACAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916275983 Original CRISPR AGATCAGATACCTTTTATTA CGG (reversed) Intergenic
No off target data available for this crispr