ID: 916275986

View in Genome Browser
Species Human (GRCh38)
Location 1:162993815-162993837
Sequence CTCCCCCTCAAAGAGCTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916275978_916275986 19 Left 916275978 1:162993773-162993795 CCCAAACATCCCAGTTTCTTTCC No data
Right 916275986 1:162993815-162993837 CTCCCCCTCAAAGAGCTTAGGGG No data
916275979_916275986 18 Left 916275979 1:162993774-162993796 CCAAACATCCCAGTTTCTTTCCG No data
Right 916275986 1:162993815-162993837 CTCCCCCTCAAAGAGCTTAGGGG No data
916275980_916275986 10 Left 916275980 1:162993782-162993804 CCCAGTTTCTTTCCGTAATAAAA No data
Right 916275986 1:162993815-162993837 CTCCCCCTCAAAGAGCTTAGGGG No data
916275977_916275986 23 Left 916275977 1:162993769-162993791 CCAGCCCAAACATCCCAGTTTCT No data
Right 916275986 1:162993815-162993837 CTCCCCCTCAAAGAGCTTAGGGG No data
916275976_916275986 27 Left 916275976 1:162993765-162993787 CCTTCCAGCCCAAACATCCCAGT No data
Right 916275986 1:162993815-162993837 CTCCCCCTCAAAGAGCTTAGGGG No data
916275983_916275986 -2 Left 916275983 1:162993794-162993816 CCGTAATAAAAGGTATCTGATCT No data
Right 916275986 1:162993815-162993837 CTCCCCCTCAAAGAGCTTAGGGG No data
916275981_916275986 9 Left 916275981 1:162993783-162993805 CCAGTTTCTTTCCGTAATAAAAG No data
Right 916275986 1:162993815-162993837 CTCCCCCTCAAAGAGCTTAGGGG No data
916275975_916275986 30 Left 916275975 1:162993762-162993784 CCTCCTTCCAGCCCAAACATCCC No data
Right 916275986 1:162993815-162993837 CTCCCCCTCAAAGAGCTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916275986 Original CRISPR CTCCCCCTCAAAGAGCTTAG GGG Intergenic
No off target data available for this crispr