ID: 916275987

View in Genome Browser
Species Human (GRCh38)
Location 1:162993817-162993839
Sequence CTCCCCTAAGCTCTTTGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916275987_916275993 -5 Left 916275987 1:162993817-162993839 CCCCCTCAAAGAGCTTAGGGGAG No data
Right 916275993 1:162993835-162993857 GGGAGAAACAGCTTAGGAATGGG No data
916275987_916275992 -6 Left 916275987 1:162993817-162993839 CCCCCTCAAAGAGCTTAGGGGAG No data
Right 916275992 1:162993834-162993856 GGGGAGAAACAGCTTAGGAATGG No data
916275987_916275995 -3 Left 916275987 1:162993817-162993839 CCCCCTCAAAGAGCTTAGGGGAG No data
Right 916275995 1:162993837-162993859 GAGAAACAGCTTAGGAATGGGGG No data
916275987_916275994 -4 Left 916275987 1:162993817-162993839 CCCCCTCAAAGAGCTTAGGGGAG No data
Right 916275994 1:162993836-162993858 GGAGAAACAGCTTAGGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916275987 Original CRISPR CTCCCCTAAGCTCTTTGAGG GGG (reversed) Intergenic
No off target data available for this crispr