ID: 916275989

View in Genome Browser
Species Human (GRCh38)
Location 1:162993819-162993841
Sequence TTCTCCCCTAAGCTCTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916275989_916275993 -7 Left 916275989 1:162993819-162993841 CCCTCAAAGAGCTTAGGGGAGAA No data
Right 916275993 1:162993835-162993857 GGGAGAAACAGCTTAGGAATGGG No data
916275989_916275996 30 Left 916275989 1:162993819-162993841 CCCTCAAAGAGCTTAGGGGAGAA No data
Right 916275996 1:162993872-162993894 TTTCCTATGCCTCTTACTACAGG No data
916275989_916275995 -5 Left 916275989 1:162993819-162993841 CCCTCAAAGAGCTTAGGGGAGAA No data
Right 916275995 1:162993837-162993859 GAGAAACAGCTTAGGAATGGGGG No data
916275989_916275994 -6 Left 916275989 1:162993819-162993841 CCCTCAAAGAGCTTAGGGGAGAA No data
Right 916275994 1:162993836-162993858 GGAGAAACAGCTTAGGAATGGGG No data
916275989_916275992 -8 Left 916275989 1:162993819-162993841 CCCTCAAAGAGCTTAGGGGAGAA No data
Right 916275992 1:162993834-162993856 GGGGAGAAACAGCTTAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916275989 Original CRISPR TTCTCCCCTAAGCTCTTTGA GGG (reversed) Intergenic
No off target data available for this crispr