ID: 916275990

View in Genome Browser
Species Human (GRCh38)
Location 1:162993820-162993842
Sequence TTTCTCCCCTAAGCTCTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916275990_916275996 29 Left 916275990 1:162993820-162993842 CCTCAAAGAGCTTAGGGGAGAAA No data
Right 916275996 1:162993872-162993894 TTTCCTATGCCTCTTACTACAGG No data
916275990_916275993 -8 Left 916275990 1:162993820-162993842 CCTCAAAGAGCTTAGGGGAGAAA No data
Right 916275993 1:162993835-162993857 GGGAGAAACAGCTTAGGAATGGG No data
916275990_916275992 -9 Left 916275990 1:162993820-162993842 CCTCAAAGAGCTTAGGGGAGAAA No data
Right 916275992 1:162993834-162993856 GGGGAGAAACAGCTTAGGAATGG No data
916275990_916275995 -6 Left 916275990 1:162993820-162993842 CCTCAAAGAGCTTAGGGGAGAAA No data
Right 916275995 1:162993837-162993859 GAGAAACAGCTTAGGAATGGGGG No data
916275990_916275994 -7 Left 916275990 1:162993820-162993842 CCTCAAAGAGCTTAGGGGAGAAA No data
Right 916275994 1:162993836-162993858 GGAGAAACAGCTTAGGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916275990 Original CRISPR TTTCTCCCCTAAGCTCTTTG AGG (reversed) Intergenic
No off target data available for this crispr