ID: 916275991

View in Genome Browser
Species Human (GRCh38)
Location 1:162993829-162993851
Sequence GCTTAGGGGAGAAACAGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916275983_916275991 12 Left 916275983 1:162993794-162993816 CCGTAATAAAAGGTATCTGATCT No data
Right 916275991 1:162993829-162993851 GCTTAGGGGAGAAACAGCTTAGG No data
916275981_916275991 23 Left 916275981 1:162993783-162993805 CCAGTTTCTTTCCGTAATAAAAG No data
Right 916275991 1:162993829-162993851 GCTTAGGGGAGAAACAGCTTAGG No data
916275980_916275991 24 Left 916275980 1:162993782-162993804 CCCAGTTTCTTTCCGTAATAAAA No data
Right 916275991 1:162993829-162993851 GCTTAGGGGAGAAACAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916275991 Original CRISPR GCTTAGGGGAGAAACAGCTT AGG Intergenic
No off target data available for this crispr