ID: 916275994

View in Genome Browser
Species Human (GRCh38)
Location 1:162993836-162993858
Sequence GGAGAAACAGCTTAGGAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916275981_916275994 30 Left 916275981 1:162993783-162993805 CCAGTTTCTTTCCGTAATAAAAG No data
Right 916275994 1:162993836-162993858 GGAGAAACAGCTTAGGAATGGGG No data
916275983_916275994 19 Left 916275983 1:162993794-162993816 CCGTAATAAAAGGTATCTGATCT No data
Right 916275994 1:162993836-162993858 GGAGAAACAGCTTAGGAATGGGG No data
916275989_916275994 -6 Left 916275989 1:162993819-162993841 CCCTCAAAGAGCTTAGGGGAGAA No data
Right 916275994 1:162993836-162993858 GGAGAAACAGCTTAGGAATGGGG No data
916275990_916275994 -7 Left 916275990 1:162993820-162993842 CCTCAAAGAGCTTAGGGGAGAAA No data
Right 916275994 1:162993836-162993858 GGAGAAACAGCTTAGGAATGGGG No data
916275988_916275994 -5 Left 916275988 1:162993818-162993840 CCCCTCAAAGAGCTTAGGGGAGA No data
Right 916275994 1:162993836-162993858 GGAGAAACAGCTTAGGAATGGGG No data
916275987_916275994 -4 Left 916275987 1:162993817-162993839 CCCCCTCAAAGAGCTTAGGGGAG No data
Right 916275994 1:162993836-162993858 GGAGAAACAGCTTAGGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916275994 Original CRISPR GGAGAAACAGCTTAGGAATG GGG Intergenic
No off target data available for this crispr