ID: 916285315

View in Genome Browser
Species Human (GRCh38)
Location 1:163099526-163099548
Sequence AGTTATTTGCAGAAGATCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916285315_916285321 22 Left 916285315 1:163099526-163099548 CCTCCGATCTTCTGCAAATAACT No data
Right 916285321 1:163099571-163099593 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
916285315_916285322 25 Left 916285315 1:163099526-163099548 CCTCCGATCTTCTGCAAATAACT No data
Right 916285322 1:163099574-163099596 GGCCTGTTACTGGGCTTTGGTGG 0: 144
1: 161
2: 86
3: 68
4: 218
916285315_916285319 15 Left 916285315 1:163099526-163099548 CCTCCGATCTTCTGCAAATAACT No data
Right 916285319 1:163099564-163099586 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
916285315_916285317 4 Left 916285315 1:163099526-163099548 CCTCCGATCTTCTGCAAATAACT No data
Right 916285317 1:163099553-163099575 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
916285315_916285320 16 Left 916285315 1:163099526-163099548 CCTCCGATCTTCTGCAAATAACT No data
Right 916285320 1:163099565-163099587 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916285315 Original CRISPR AGTTATTTGCAGAAGATCGG AGG (reversed) Intergenic
No off target data available for this crispr