ID: 916287543

View in Genome Browser
Species Human (GRCh38)
Location 1:163126911-163126933
Sequence TGTCAGATGCTGGAAGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 2, 3: 54, 4: 395}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916287543 Original CRISPR TGTCAGATGCTGGAAGAGGG TGG Intronic
900640204 1:3684846-3684868 AGGCAGATGCTGGGAAAGGGTGG + Intronic
900801758 1:4741363-4741385 TCCCAGAAGCTGGAAGAGGCCGG - Intronic
901437093 1:9253847-9253869 TGACAGATGCTGTAAGAGAAGGG - Intronic
902316896 1:15627784-15627806 TGACAGATGCTGGCAGAGTCTGG + Intronic
902491439 1:16784937-16784959 TGTCAAATGGGGCAAGAGGGTGG + Intronic
903516105 1:23912067-23912089 TGTCTGATGCGGGCACAGGGCGG - Intronic
904715668 1:32465545-32465567 CGTCTGATGCTGGACGGGGGAGG + Intronic
904923671 1:34028987-34029009 TTTCACATTCTGGATGAGGGTGG + Intronic
905064345 1:35167156-35167178 TGACAGAAGCTGGAGGATGGGGG + Intergenic
905448322 1:38042025-38042047 TGTCAGCTGCAGGCAGAGGCCGG + Intergenic
906165037 1:43679836-43679858 TGCCAGATGTTGGATGAGGGAGG + Intronic
909671189 1:78190516-78190538 TGTCAGAGGGTGGGAGTGGGAGG - Intergenic
910724514 1:90324425-90324447 TGTCACAGGTTGGAAGAGGTAGG + Intergenic
911133071 1:94410580-94410602 TGACAGAGGCTGGAGGAGAGAGG + Intergenic
912192251 1:107353603-107353625 TGGCAGAGGCTGGAGGAGTGTGG - Intronic
912413909 1:109495362-109495384 TGTCAGATGGTTGAAAAGGGCGG + Intronic
912475030 1:109929567-109929589 TGGCAGGTGCTGGAAGGAGGAGG - Exonic
913215106 1:116613693-116613715 TGTCAGATACTGGGAGAATGTGG - Intronic
913444811 1:118939541-118939563 TGCTAGATGGTGGAAGAGGGAGG + Intronic
913544001 1:119848792-119848814 TGTCAGAGACTGCAAGAAGGGGG - Intergenic
914212728 1:145595258-145595280 TGTCAGAGACTGCAAGAAGGGGG - Intergenic
914905006 1:151736785-151736807 TGGCAGAGGTTGGAAGAGTGTGG + Intergenic
915002511 1:152606430-152606452 TGACAGATGCCGGTAAAGGGTGG + Intergenic
916287543 1:163126911-163126933 TGTCAGATGCTGGAAGAGGGTGG + Intronic
916349444 1:163832417-163832439 TCTCAGATGCTAGAAGTGAGAGG + Intergenic
916442728 1:164843375-164843397 TGGCATATCCTGGAATAGGGTGG + Intronic
917777561 1:178353582-178353604 TGGTAGAAGCTGGAAGAGTGTGG - Intronic
918106949 1:181423752-181423774 TGTCTGATGCTGGCAGCAGGTGG - Intronic
918523820 1:185443333-185443355 TATCAGATTCTAGAAGAGGCAGG + Intergenic
918961074 1:191278771-191278793 TGTCAGGAGATGGAGGAGGGGGG - Intergenic
920407866 1:205732364-205732386 TGCCAGAGGCTGGAAGAGTGGGG + Intronic
920459095 1:206124546-206124568 TGTCAGGAGCTGGGAGTGGGAGG - Intergenic
920587245 1:207178403-207178425 TGCCAGAGGCTGGAGGAGGGAGG - Intergenic
921214079 1:212922452-212922474 TGGCAGATGCTGTAAGAGGTAGG - Intergenic
923183452 1:231546857-231546879 TGACAGATTGTGGAAAAGGGAGG + Intronic
923529004 1:234797605-234797627 TGTCAAATGGGGCAAGAGGGTGG - Intergenic
923629002 1:235637321-235637343 AGTCAAACGCTGGAAGATGGGGG + Intronic
923773966 1:236961727-236961749 TGACAGAGGAAGGAAGAGGGCGG - Intergenic
924393598 1:243591462-243591484 TGTCAGATGCTGGAAGTTTGGGG - Intronic
924563697 1:245178570-245178592 TTTGAGATGATGGAAGTGGGTGG - Intronic
924949642 1:248870727-248870749 TATCAGAGGCTGGGAGAGGGGGG + Intergenic
1062984109 10:1751159-1751181 TGTCAGAGCTTGGAAGAGGAAGG + Intergenic
1064390967 10:14941861-14941883 TCCCAGATGCTGAAAGAAGGAGG - Intronic
1064401331 10:15023870-15023892 TCCCAGATGCTGAAAGAAGGAGG - Intergenic
1064513156 10:16117139-16117161 TGTCAGATTCTGGCAGCGTGAGG + Intergenic
1065852112 10:29799279-29799301 TGCCAGATGCAGGCAGAGTGGGG + Intergenic
1066535186 10:36383495-36383517 TACCAGATGCAGGAAGTGGGAGG - Intergenic
1066642842 10:37573664-37573686 TACCAGATGCTGGAAGTGGGAGG - Intergenic
1067056831 10:43057407-43057429 TGTGAGAAGCTGAAAGAGTGTGG - Intergenic
1067169780 10:43897264-43897286 TGTCTGAGGGTGGGAGAGGGTGG + Intergenic
1067839811 10:49666591-49666613 TGTCACAGGCTGGCAGAGGTGGG + Intergenic
1068914052 10:62409199-62409221 TGTCTGGTGATGGAAGAGAGTGG + Intronic
1070532149 10:77346398-77346420 TGCAAGATGCTGGAATAGGAGGG - Intronic
1072126693 10:92451707-92451729 TGTCCTATGCTGGAAAAGTGAGG + Exonic
1072767577 10:98108155-98108177 TGGGAGATGGTGGAGGAGGGAGG - Intergenic
1073288285 10:102401166-102401188 TGTCAGCACCTGGGAGAGGGAGG - Exonic
1073510046 10:104037166-104037188 TTTCAGATTCTGGAATAGTGAGG - Intronic
1074143755 10:110698808-110698830 CTTCAGATGCTGGCAGAGGATGG + Intronic
1075583431 10:123639702-123639724 CATCAGAAGGTGGAAGAGGGTGG - Intergenic
1075773104 10:124957562-124957584 TGTCAGGGGCTGGAGGAAGGGGG - Intronic
1076154073 10:128189253-128189275 TGTCAGATGGTGGGAAAGAGGGG + Intergenic
1076375187 10:129979003-129979025 TGTCAAGTGCTGGGAGTGGGAGG - Intergenic
1076746547 10:132517534-132517556 TCTCAGAGCCCGGAAGAGGGAGG + Intergenic
1078193616 11:9115436-9115458 TGTCAGAAGCTAGGAGAGGTTGG - Intronic
1078315040 11:10287931-10287953 TGTCAGCTGCTGCCACAGGGTGG + Intronic
1080564224 11:33493303-33493325 TGGCAGAAGATGGAAGAAGGGGG - Intergenic
1083725374 11:64625258-64625280 TCTCTGATTCTGGAAGAGGGAGG + Intronic
1083774161 11:64885076-64885098 TGTCAGATGCTGAAGGAAGGTGG - Intronic
1084324613 11:68392662-68392684 TGACAGAGGCTGGGAGAGAGGGG - Intronic
1085872374 11:80365793-80365815 TGACACATGCTGGGACAGGGAGG + Intergenic
1086467119 11:87066044-87066066 TTTCAGAGGCTTGAAGAGGGAGG + Intronic
1087044162 11:93830379-93830401 TCTCAGAGGCTGGCACAGGGTGG - Intronic
1088119152 11:106347637-106347659 TGCCAGAGGCTGGAGGAGGCAGG - Intergenic
1088532633 11:110827421-110827443 TCCCAGAAGCTGGAAGAGGTAGG + Intergenic
1089402180 11:118170686-118170708 CATCAGAAGCTGGAAGAGTGGGG + Intronic
1089596513 11:119584375-119584397 AGGCAGATAATGGAAGAGGGGGG + Intergenic
1089744994 11:120610451-120610473 TGTGTGTTGCTGGGAGAGGGTGG + Intronic
1090064507 11:123491570-123491592 TGCCAGATGTTGAAAGATGGAGG + Intergenic
1090670016 11:128939473-128939495 TTTCAGTGGCTGGAAGACGGAGG - Intronic
1091446712 12:547936-547958 TGTAAGGTGCTGGAAGGGGGTGG + Intronic
1091988348 12:4932752-4932774 TGCCAGAAGCTAGAAGAGGCAGG - Intergenic
1092504760 12:9086100-9086122 TGCCAAAAGCTGGAAGAGGAAGG + Intronic
1092664123 12:10775316-10775338 TGTCAGAGGCTGGAGGCAGGAGG - Intergenic
1092853180 12:12649074-12649096 AGGCAGATGTTGGAAGAGTGTGG - Intergenic
1092933311 12:13337599-13337621 TGCCAGATGCTGGAACATGAAGG - Intergenic
1093189101 12:16054814-16054836 TGTCAGATGGTGGAGGTGGAGGG + Intergenic
1094057900 12:26285291-26285313 TGGCAGATGCTGGAGGTGGGAGG + Intronic
1094241883 12:28237585-28237607 TATCAGAAGCTGGAACAGGCAGG + Intronic
1094352896 12:29546277-29546299 TGTCACTTGCAGGAGGAGGGTGG + Intronic
1095991641 12:48038683-48038705 TGTGAGAACCTGGAATAGGGTGG + Intergenic
1096464868 12:51842723-51842745 TTTCAGAGGCTGTAAGGGGGAGG - Intergenic
1096567451 12:52493219-52493241 TGTGAGAGGCTGGAGGAGAGAGG + Exonic
1097104782 12:56615508-56615530 TGTGAGGTGCTGGAGGAGTGGGG + Exonic
1097994817 12:65876923-65876945 AGTGAGGTGCTGGAGGAGGGTGG + Intronic
1098644482 12:72881276-72881298 GGGCAGAGGCTGTAAGAGGGTGG - Intergenic
1099487681 12:83248645-83248667 AGTCAGATGCTGGAACAGCTTGG + Intergenic
1102933910 12:116881477-116881499 TGTCACATGGTGGAGGGGGGCGG + Intergenic
1103316816 12:120062836-120062858 AGTCAGAGGCTGGCAGAGGCAGG - Intronic
1103422565 12:120799565-120799587 TATCAGATGGTGGGGGAGGGTGG + Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1103883248 12:124182680-124182702 CATGAGCTGCTGGAAGAGGGTGG + Intronic
1103993436 12:124814428-124814450 TGTCAGAGGCTGGACGTGGCTGG + Intronic
1104051919 12:125200750-125200772 TGGGAGATGGTGGAAGAAGGGGG + Intronic
1104412853 12:128573685-128573707 TGCCAGAGGCTGGAGGAGGGAGG + Intronic
1104529412 12:129554745-129554767 CATCAGATGCTGCAGGAGGGAGG + Intronic
1104887409 12:132118786-132118808 TGTCAGATACTGGGAGAGCTGGG + Intronic
1105286453 13:19008456-19008478 TGGCAGATGGAAGAAGAGGGAGG - Intergenic
1105356972 13:19667524-19667546 TGTCAGGGGCTGGGGGAGGGAGG - Intronic
1106138263 13:26990621-26990643 GGTCAGCTGCTGGCAGAGGCAGG - Intergenic
1106992697 13:35441159-35441181 TGTGAGATGATGGAAAATGGGGG - Intronic
1108467161 13:50727861-50727883 TGTCTCATTCTGGAAGAGGCTGG - Intronic
1110053889 13:70940338-70940360 TGTGATATGGTGGCAGAGGGTGG - Intergenic
1110073824 13:71213613-71213635 TGTCATGTGCTGGAAAAGGGAGG - Intergenic
1110868676 13:80424873-80424895 AGGCAGAGGCTGGAAGAGTGTGG - Intergenic
1112749534 13:102567951-102567973 TGGAAGAAGCTGGGAGAGGGAGG - Intergenic
1112940786 13:104859655-104859677 TGGCAAATGCTAGAAGAGAGAGG + Intergenic
1113275861 13:108729033-108729055 TTTCAAATTCTGGAAGATGGAGG + Intronic
1113472535 13:110557166-110557188 TATCAGAAGCTGGAGGAGGGAGG + Intronic
1113755962 13:112811208-112811230 TGTGGGATGCTGGCAGAGGGAGG - Intronic
1114149942 14:20026894-20026916 TTTCAGAGGCTGGAGGAGGCAGG - Intergenic
1115161756 14:30404308-30404330 TGCCAGGGGCTGGAAGAAGGGGG - Intergenic
1115930953 14:38493921-38493943 TGTCAGATGTTGGAAAGGGAAGG - Intergenic
1117645545 14:57848239-57848261 AGTCAAATGCTGAATGAGGGTGG - Intronic
1117898289 14:60509450-60509472 TGTGAGACCCTGGAAGAGAGCGG + Exonic
1118674261 14:68165966-68165988 TATCTTATGCTGTAAGAGGGTGG + Intronic
1118755761 14:68842735-68842757 TGTCATCTGCTGGAAAAGGAGGG - Intergenic
1119025669 14:71150332-71150354 GGGCAGAGGCTGGAAGAGTGTGG + Intergenic
1119824892 14:77649422-77649444 GGACAGCTGCTGGAAGAAGGAGG + Intergenic
1120072713 14:80121943-80121965 TGTCAGAGGTTGGAAGAGTTTGG + Intergenic
1120223399 14:81761649-81761671 TGTTAGATGTTGGAAGAAAGAGG + Intergenic
1120422312 14:84303294-84303316 TGTCAGATGCTGCAGCAGGGTGG - Intergenic
1121164017 14:91774533-91774555 TGGCAGGTCCTAGAAGAGGGAGG - Intronic
1124180102 15:27465136-27465158 TCTCAGCTGCTGGTGGAGGGGGG + Intronic
1124644673 15:31429417-31429439 TGCCAGGGGCTGGAAGAGGGGGG + Intronic
1125072241 15:35568904-35568926 TGCCAGAGGCTGGAAGAAGGGGG - Intergenic
1125446169 15:39759731-39759753 CATCAGAAGCTGGAAGAGGGAGG - Intronic
1125625885 15:41108914-41108936 TGCCACATCATGGAAGAGGGAGG + Intronic
1125753006 15:42043210-42043232 TGTCAGCTGCTGGAAGCATGTGG + Intronic
1126132847 15:45359850-45359872 TGTGATACGCTGGAAGCGGGAGG - Intergenic
1126512945 15:49501198-49501220 GGGCAGAGGCTGGAAGAGTGTGG + Intronic
1127155889 15:56123901-56123923 TGGCAGGTGCTGGGAGATGGGGG + Intronic
1127650958 15:61006613-61006635 TTTCAGAGGCTGGCAGAGGAAGG - Intronic
1127731736 15:61808267-61808289 AGTGAGATGGTTGAAGAGGGAGG - Intergenic
1128307025 15:66605394-66605416 TGTCTGATGGGGGAGGAGGGAGG + Intronic
1128346406 15:66855192-66855214 TGTCTGAGGCTGGAGGTGGGAGG - Intergenic
1128774429 15:70308920-70308942 TCTCAGCAGCTGGAAGAGTGAGG - Intergenic
1128802035 15:70502975-70502997 TCTCAGATGCTAGAAGTGGCAGG - Intergenic
1130430879 15:83845857-83845879 TGTCACAACCTGCAAGAGGGAGG + Intronic
1130678257 15:85973545-85973567 TGCCAGAAACTGGAAGAGGCAGG + Intergenic
1130705261 15:86227118-86227140 TGTTAGATTCTGGTAGAAGGGGG - Intronic
1131064387 15:89424466-89424488 TGGCAGAGGCTTGGAGAGGGAGG + Intergenic
1131577006 15:93602264-93602286 CCTCAGAAGCTGGAAGAGAGAGG - Intergenic
1132093121 15:98961591-98961613 TGTGAGCTGCTGGCAGAAGGAGG - Exonic
1132600759 16:771777-771799 TGCCAGAAGCTGGAGGAGGCAGG + Intronic
1133030535 16:3008735-3008757 TAGGAGAGGCTGGAAGAGGGTGG - Intergenic
1133617032 16:7486810-7486832 TGACGGATGCTGGAAGAGGCAGG - Intronic
1137076186 16:35964748-35964770 TGTCAGGTGGGGGAGGAGGGAGG + Intergenic
1137465114 16:48700696-48700718 CATCAGATGGGGGAAGAGGGAGG - Intergenic
1137919537 16:52473516-52473538 GGTCACATGCTGGCAGAGGCCGG + Intronic
1137936532 16:52640232-52640254 TGTGAGAAGAAGGAAGAGGGAGG + Intergenic
1138027267 16:53531764-53531786 TGGCAGATGCAGGAGGAGGAAGG - Intergenic
1138234586 16:55371238-55371260 TGTCAGATGCTGGACCGGGCCGG - Intergenic
1139083997 16:63561998-63562020 TGGCAGAGGCTGGAAGAGTTTGG - Intergenic
1139319489 16:66101917-66101939 TGTGAGAGGGTGGAAAAGGGAGG - Intergenic
1139379190 16:66519888-66519910 AGTAAGAGGCTGGAAGAGTGAGG + Intronic
1140848257 16:78910306-78910328 TCAGAGATGCTGGAAGATGGAGG - Intronic
1141667275 16:85472334-85472356 TACCAGAGGCTGGAAGAGGCAGG - Intergenic
1141716455 16:85729806-85729828 TATCAGAAGCTGGAAGAGGCAGG + Intronic
1141983202 16:87562375-87562397 TGGCAGATGGTGGCAGAGGGGGG + Intergenic
1142382291 16:89739707-89739729 TGTCAGCAGCTGGGAGAGGATGG + Intronic
1143739024 17:8939061-8939083 TGTCAGCTGCTGGAAGAGGCAGG + Intronic
1144603650 17:16643504-16643526 TGTCAGAGGCTGTAAGGAGGGGG + Intronic
1144684675 17:17218172-17218194 AGTCAGATGCCGGGAGAGAGGGG - Intronic
1145059208 17:19721546-19721568 TGCCAAGTGCTGGAAGATGGTGG + Intergenic
1145239435 17:21231537-21231559 TGGAAGATCCTTGAAGAGGGAGG + Intergenic
1145860964 17:28209654-28209676 TGTCAGGGGCTGGATGAGGACGG + Intergenic
1148105550 17:45116820-45116842 TGGGAGATACTGGCAGAGGGAGG - Intronic
1148715141 17:49710726-49710748 ATTCAGCTGCTGGCAGAGGGAGG - Exonic
1149979758 17:61300821-61300843 GGGCAGAGGCTAGAAGAGGGAGG - Intronic
1150143410 17:62749058-62749080 TCTCAGATCCTGGAAGTAGGGGG - Intronic
1151222686 17:72624801-72624823 TGTCCAATGCTGGAAGAAGAGGG - Intergenic
1151287234 17:73121692-73121714 TGTGCACTGCTGGAAGAGGGTGG + Intergenic
1151511614 17:74564366-74564388 TGCCTGAGGCTGGAGGAGGGAGG + Intergenic
1152278462 17:79371733-79371755 TGGCAGATCCTGCAAGTGGGAGG + Intronic
1152387685 17:79984899-79984921 TGTCCGAAGCTGGAGGATGGTGG - Intronic
1152534601 17:80943199-80943221 TGTCAGCTGCTGGAGGTGGGCGG + Intronic
1152612990 17:81324609-81324631 TGGCAGATGCTGGGAGATGCTGG - Intronic
1152759618 17:82101125-82101147 TGTCAGGTGCTGGCAGGGTGGGG - Intergenic
1153319795 18:3761247-3761269 TGCCAGAGGCTGGGGGAGGGAGG - Intronic
1153727870 18:7976287-7976309 TGACAGAAGCTGGGAGAGGCAGG + Intronic
1154282034 18:13012133-13012155 TGTCAGAGGCTGGAAGGTAGCGG + Intronic
1154285606 18:13053582-13053604 TGTATGAGGCTAGAAGAGGGGGG + Intronic
1155245463 18:23904496-23904518 TGTCAGCTGCTGGCAGAGGAAGG + Intronic
1156484999 18:37459530-37459552 TGTGATGTGCTGGAAGTGGGAGG + Intronic
1156708635 18:39914392-39914414 TGTCAGAAGCTGGGAGATGAGGG - Intergenic
1157685559 18:49640079-49640101 TGAGGGAGGCTGGAAGAGGGAGG + Intergenic
1157831174 18:50858308-50858330 TGCCAGGGGCTGGAAGAGAGGGG - Intergenic
1158941927 18:62412506-62412528 CGTCAGACCCTAGAAGAGGGAGG - Intergenic
1160318329 18:77868230-77868252 TGTCAGCCGCTGGAAGAGCAGGG + Intergenic
1160372239 18:78383489-78383511 ACTCAGAGGCTGGAAGAGAGGGG - Intergenic
1161059678 19:2208640-2208662 TCTCTGCTTCTGGAAGAGGGAGG - Intronic
1161145567 19:2676126-2676148 TGCCAGATGCTGGAAGAGGCAGG + Intronic
1161716790 19:5880716-5880738 TGTCAGAGGCTGGGGGTGGGGGG + Intronic
1161853535 19:6751216-6751238 TGCCAGAGACGGGAAGAGGGGGG + Exonic
1162855588 19:13465983-13466005 TGCCAGAGGCTGGAGGAAGGTGG + Intronic
1163610103 19:18296191-18296213 TGAGAGATGCAGGAAGAGAGAGG - Intergenic
1163759551 19:19128106-19128128 TGTCAGGGGCTGCAAGAAGGAGG + Intronic
1164418417 19:28066031-28066053 TGTCAGATGCTGGAATCTGTGGG - Intergenic
1165397981 19:35577591-35577613 TGTGAGAGGCTAGAGGAGGGTGG - Intergenic
1165648728 19:37467684-37467706 TGACAGCGGCTAGAAGAGGGAGG + Intronic
1166645566 19:44529419-44529441 CTTCAGATGCGGGAGGAGGGAGG - Intronic
1167298905 19:48668000-48668022 TGTCTCAGGCTGGAGGAGGGAGG + Intronic
1167671400 19:50855799-50855821 GTTCAGTTGCTGGAAGAGGAAGG - Intronic
1167720975 19:51180080-51180102 TGTCAGATGCCTGAAAAGGCTGG - Intergenic
1168700215 19:58433923-58433945 TTTCTGGTGCTGGATGAGGGTGG + Exonic
926023194 2:9515166-9515188 TGCTAGATGCTGGGGGAGGGAGG - Intronic
926212029 2:10878439-10878461 TGGAAGGTGCTGGCAGAGGGTGG + Intergenic
927969061 2:27292721-27292743 TGCCAGTTGCTGGAAGGAGGGGG - Intronic
928008970 2:27590129-27590151 TATCAGTTGCTGAAAGGGGGAGG + Intronic
929266883 2:39928430-39928452 GGTGAGAGGCTGGAAGAGGAGGG + Intergenic
929425510 2:41840927-41840949 TGGCTGTTGCTGGAAGGGGGCGG - Intergenic
929546214 2:42856644-42856666 CCTCAGATGCAGGGAGAGGGTGG - Intergenic
929846269 2:45531970-45531992 TATCAGAAGATTGAAGAGGGTGG - Intronic
929863799 2:45700837-45700859 AGGCAGATGCAGGGAGAGGGCGG + Intronic
930002275 2:46869450-46869472 TGAGTGAGGCTGGAAGAGGGTGG - Intergenic
930228226 2:48816435-48816457 TGTCAGAGGGTGAAAGTGGGAGG - Intergenic
932960351 2:76406295-76406317 TGCCCAATGCTGGCAGAGGGTGG - Intergenic
934101732 2:88659830-88659852 TGGCAGAAGCTGGAAAAGTGAGG + Intergenic
934295475 2:91739452-91739474 TGTCAGATACTGGGAGAATGTGG + Intergenic
935529132 2:104211456-104211478 TGTCACATGGTGGAAGAAGGAGG + Intergenic
936081327 2:109434562-109434584 ACTCAGAAGCAGGAAGAGGGTGG - Intronic
936090757 2:109499995-109500017 TTACAGATGGTGGAAGCGGGTGG + Intronic
936562888 2:113557163-113557185 TGCCAGAAGCTGGAAGAGGCAGG - Intergenic
936613769 2:114027611-114027633 TGTGTCATGCTGGAAGAGTGGGG - Intergenic
938701741 2:133885716-133885738 TACCAGAAGCTGGAAGAGGCAGG + Intergenic
939159351 2:138567965-138567987 TGCCAGATCATGGAAGTGGGAGG + Intronic
940385205 2:153063636-153063658 TCTCACATGGTGGAAGAGGCAGG - Intergenic
941441604 2:165544651-165544673 TGTGAGATGCTAGAAAAGGGTGG + Intronic
942695902 2:178645028-178645050 TGTCTTATGCTGGAAGACTGTGG + Intronic
943026891 2:182640570-182640592 TATCAAATGGTGGAAGAAGGAGG + Intergenic
944162648 2:196681116-196681138 TGTCAGGGGCTGGGAGAAGGAGG - Intronic
944860622 2:203812493-203812515 TGTTTCATGCTGGAAGAAGGAGG + Intergenic
945222355 2:207497780-207497802 TGCTAGATGCTGGAAAAGGCAGG - Intergenic
946367211 2:219255796-219255818 TGTCAGGTGATGGGGGAGGGAGG - Intronic
947133480 2:226953940-226953962 TCTCACATGTGGGAAGAGGGTGG + Intronic
948172983 2:235920525-235920547 TTTGGGATGCTGGAAGATGGGGG + Intronic
1168889593 20:1286259-1286281 TCACACTTGCTGGAAGAGGGTGG - Intronic
1169456635 20:5758207-5758229 TGTCAGATGCAGGGACAGTGAGG + Intronic
1170978720 20:21190957-21190979 TGTAAGATGGAGGAGGAGGGAGG + Intronic
1172192079 20:33068234-33068256 TGTCAGAAGGTGGAAGAGCATGG + Intronic
1172619869 20:36311801-36311823 TGACAGAGGCTGGAAGACAGAGG + Intronic
1174495339 20:50937515-50937537 TGTCAGATGCTGTTAGGGGAGGG + Intronic
1174548589 20:51344815-51344837 AGTCAGGTGCAGGAAGAGGTGGG - Intergenic
1174832961 20:53830473-53830495 TGTCTGATGATGGAGGGGGGTGG - Intergenic
1174958071 20:55123367-55123389 TGCCAGAGGCTGGGAGAGTGAGG + Intergenic
1175146484 20:56900463-56900485 TTTCAGATGGTGGAAGAGCCAGG + Intergenic
1175261690 20:57678572-57678594 TGGCAGATGCTGTGAGCGGGAGG - Intronic
1175327619 20:58140661-58140683 CCCCAGAAGCTGGAAGAGGGTGG - Intergenic
1175563650 20:59954837-59954859 AGGCAGAGCCTGGAAGAGGGAGG - Intergenic
1176216710 20:63951550-63951572 TTTCAGATGGTGCCAGAGGGTGG - Intronic
1176691874 21:9921988-9922010 CCTCACATGGTGGAAGAGGGAGG - Intergenic
1178062883 21:28871791-28871813 TGCCAGAGGCTGGAAGAGGCAGG - Intergenic
1178472463 21:32905604-32905626 TGTCACAGGCTGGGAAAGGGTGG + Intergenic
1178683034 21:34689178-34689200 TTCCAGATGCAGGGAGAGGGTGG + Intronic
1180134629 21:45854417-45854439 TGCCAGAGGCTGGGGGAGGGAGG - Intronic
1180981334 22:19879508-19879530 TGGAAGAAGCTGGAAGAGGATGG + Intronic
1181534065 22:23532817-23532839 TGCCAGATGGGGGAAGAGGGAGG + Intergenic
1183002104 22:34869217-34869239 TCTCAGAGGCTGGAACTGGGTGG + Intergenic
1183482532 22:38072986-38073008 CGTCAGCATCTGGAAGAGGGTGG - Exonic
1183791201 22:40071615-40071637 GGTCAGAAGCTGGAGGAGTGAGG - Intronic
1184020892 22:41820734-41820756 TTTCAAATGCTTGGAGAGGGAGG + Intronic
1184920197 22:47600603-47600625 TGTCAGAGGCTGGGAGGGGCGGG - Intergenic
1185014565 22:48335455-48335477 TGTCAGAAGCTGGGAGTGGAGGG - Intergenic
1185123818 22:48992683-48992705 TATCAGAGGCTGGGAAAGGGAGG + Intergenic
949105572 3:197379-197401 TGGCGGAGGCTGGAAGCGGGAGG - Intronic
949681202 3:6516467-6516489 TCTCTGATGCTGGGAGTGGGAGG + Intergenic
950882721 3:16336147-16336169 AGGCAGATGCTGGAACACGGCGG + Intronic
951066763 3:18276027-18276049 TCTCATATGCTGGAAGGGGCAGG - Intronic
951346631 3:21554814-21554836 TGTCTGAAGCTGGAAGTGGTTGG - Intronic
953740475 3:45534315-45534337 CCTCAGATGCTGGGAGAGGCAGG - Intronic
954542683 3:51405394-51405416 TGTCTGCTGCTGGAAGAGTTTGG - Intronic
954755276 3:52835835-52835857 TTTCAGTTGCTCAAAGAGGGTGG + Intronic
955412751 3:58666664-58666686 TGTCAGAAGCTGGCCCAGGGTGG - Exonic
955953687 3:64267158-64267180 TCTCAGATGCTGGAAGAGTCAGG - Intronic
956704931 3:71991518-71991540 TGTCACATGGTGGGAGAGGGAGG + Intergenic
956871884 3:73426656-73426678 TCAAAAATGCTGGAAGAGGGAGG - Intronic
957552364 3:81723207-81723229 TGTCAGTTTCTGGTATAGGGTGG - Intronic
957723273 3:84031934-84031956 GGTCAGATGCTGGTGGAGGTGGG - Intergenic
957768467 3:84657721-84657743 GGGCAGAGGTTGGAAGAGGGTGG + Intergenic
958026731 3:88058684-88058706 TGTCGGAGGGAGGAAGAGGGAGG - Intronic
959363623 3:105427584-105427606 TGTCAGATGAGGGGAGGGGGTGG - Intronic
959676662 3:109043392-109043414 TGTCAGAGGATGGAAAAGCGGGG + Intronic
960724834 3:120659632-120659654 TGGCAGAGGTTGGAAGAGTGTGG - Intronic
961099416 3:124185922-124185944 TGCCAGTTGCTGGGAGATGGAGG + Intronic
961374701 3:126456500-126456522 TGTCACATGCTGGGAGAAGTTGG + Intronic
961512480 3:127411540-127411562 GGCCACATGCTGGGAGAGGGTGG - Intergenic
961806275 3:129491591-129491613 AGACAGATTCTGGAAGAAGGTGG - Intronic
962817214 3:139012252-139012274 TGTCCTATGCTGAAAGTGGGGGG + Intronic
965123478 3:164594178-164594200 TTTCAGCTGCAGGAAGAGGGAGG + Intergenic
966223090 3:177569901-177569923 TGCCAGATGCCGGAAAAGGCAGG - Intergenic
967034858 3:185640891-185640913 TGTAAGATCCTGGATGAAGGTGG + Intergenic
967681271 3:192366784-192366806 TGTGAGAGCCTAGAAGAGGGAGG + Intronic
968560406 4:1277927-1277949 TGACAGTTGCTGGATGGGGGTGG - Intergenic
968848801 4:3063591-3063613 TGGCAGATGCTTGGAGAGAGGGG + Intergenic
968942070 4:3644081-3644103 CGACAGAAGCTGGAAGAGGCAGG + Intergenic
969177147 4:5407363-5407385 TGGCAGAGGTTGGAAGAGTGCGG - Intronic
969189793 4:5508152-5508174 TGTAAGATGCTGGAATTAGGGGG + Intergenic
969211804 4:5693504-5693526 CACCAGAAGCTGGAAGAGGGAGG + Intronic
969473275 4:7402627-7402649 AGTCAGATGCTTGGATAGGGTGG + Intronic
969996978 4:11323386-11323408 AGGCAGAGGCTGGAAGAGTGTGG + Intergenic
970656514 4:18236385-18236407 TACCAGAAGCTGGAAGAGGCAGG + Intergenic
972238984 4:37168391-37168413 TGTCAGTTGCTTGCAGAGGTGGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972949038 4:44295470-44295492 TGTCAGTTTCTGGGAAAGGGAGG + Intronic
972980982 4:44700827-44700849 TATCAGAACCTGGAAGAGGGAGG - Exonic
975086917 4:70352774-70352796 TGGCGGATGCTGAAAGAGTGAGG - Intergenic
978640583 4:110866693-110866715 TGTGAGATTCTGGAATAGAGAGG - Intergenic
979170605 4:117597063-117597085 TATCAGATGGTGTAAGAGGTGGG - Intergenic
979411179 4:120381670-120381692 TATCAGAGGCTGGGAGTGGGGGG + Intergenic
980169089 4:129265331-129265353 TGTCAGGAGCTGGAAGACGGTGG - Intergenic
980364460 4:131782191-131782213 CCTCACATGGTGGAAGAGGGAGG - Intergenic
981298729 4:143163145-143163167 AGTAAGTGGCTGGAAGAGGGGGG - Intergenic
985658918 5:1146052-1146074 TGTCAAATTCTGGGAGACGGAGG - Intergenic
985930009 5:3049733-3049755 TGTCAGATGCAGGAATGGGCAGG - Intergenic
987048965 5:14133484-14133506 TGCCAGAAGCTGGCAAAGGGAGG - Intergenic
987440888 5:17955213-17955235 TGTTAGGGGCTGAAAGAGGGAGG + Intergenic
987770765 5:22301192-22301214 GAGCAGATGCTGGAATAGGGTGG + Intronic
989460217 5:41688985-41689007 TATCAGAGACTGGAAAAGGGAGG - Intergenic
990279165 5:54231356-54231378 TGTTATAGGCTGGATGAGGGTGG - Intronic
990835894 5:60019617-60019639 AGTCAGATGCTAGGAGAGGTTGG - Intronic
991029588 5:62068748-62068770 AGTCACATGCTGGAACAGTGGGG + Intergenic
991136148 5:63184951-63184973 TGGCAGAGGTTGGAAGAGTGTGG + Intergenic
991290276 5:65027112-65027134 TGGTAGCTGCTGGAAGAGGAGGG + Intergenic
991303286 5:65149522-65149544 TGGCTGATGCTGGAAGAGGAGGG - Exonic
991546493 5:67787748-67787770 AGTCAGAGGCTGGAATAGGTGGG - Intergenic
993899321 5:93573485-93573507 TGGGAGATCCTGGAAGACGGAGG + Intergenic
994150417 5:96441193-96441215 TGTCAAATTCTGGAGTAGGGAGG + Intergenic
997958074 5:138296099-138296121 TGTCAGATGCTGCAACATGAAGG - Intronic
998591571 5:143484668-143484690 TGTTAGTTCCTTGAAGAGGGAGG - Intergenic
998737968 5:145164670-145164692 TGTCTAATGCTGAAAGTGGGAGG + Intergenic
999394025 5:151215117-151215139 TGTCAGTAGCTGGATGGGGGTGG + Intronic
999399926 5:151256863-151256885 TGTCATAGGCTGGAGGAGAGGGG - Intronic
1000200819 5:159008964-159008986 TGTAAGATGCTGGAAGTAGGAGG + Intronic
1000257325 5:159552321-159552343 TATCAGATGATGGAGGAAGGTGG + Intergenic
1000608078 5:163345412-163345434 TGTTAGAAGCTGGAAAAGGCAGG - Intergenic
1001952724 5:175827390-175827412 TGTCAGATGCTGGAAAGAAGAGG - Intronic
1002523007 5:179801618-179801640 TGGCAGGTGATGGAAGACGGTGG + Exonic
1003009942 6:2417271-2417293 CATCAGAAGCTGGAAGAGGCAGG + Intergenic
1003450029 6:6222303-6222325 TGTTCCATGCTGGAAAAGGGTGG + Intronic
1004558084 6:16719659-16719681 TGTCAGGGGCTGGAAAAGGAAGG - Intronic
1006030044 6:31171617-31171639 AGTCTGATTCTGGAAGACGGAGG - Intronic
1006104249 6:31707076-31707098 TGTCAGAGGCAGGAGGAGGTTGG - Intronic
1006672138 6:35736208-35736230 ATGCAGATGCTGGAAAAGGGTGG + Intergenic
1007118705 6:39362721-39362743 TGACAGATGTTGGCAGTGGGAGG - Intronic
1007173699 6:39882297-39882319 TGGCAGATGCTGGAAGCTGGGGG + Intronic
1007402394 6:41610821-41610843 TGTGAGAAGCTGGATGGGGGTGG + Intergenic
1008354588 6:50537142-50537164 TGTGAGGTGGGGGAAGAGGGAGG - Intergenic
1009824801 6:68854661-68854683 TGTAAAATGCTGGCACAGGGAGG - Intronic
1010348383 6:74840494-74840516 AGGCAGAGGCTGGAAGAGGTTGG + Intergenic
1010764683 6:79765393-79765415 AGCCACAGGCTGGAAGAGGGCGG + Intergenic
1014566419 6:122954883-122954905 TCTAAAATGCTGGAAGAGAGTGG + Intergenic
1015407901 6:132857751-132857773 TGTCAGAAGCTGGAGCAGGGAGG - Intergenic
1015577636 6:134689967-134689989 TGAGAGATGCTGCAAGTGGGAGG + Intergenic
1016949214 6:149564530-149564552 TGTGAGCTCCAGGAAGAGGGTGG - Intergenic
1018022898 6:159778691-159778713 AGCCAGATGCTCCAAGAGGGTGG - Exonic
1018927265 6:168215095-168215117 GGTCAGGTGCAGGGAGAGGGAGG - Intergenic
1019183083 6:170204719-170204741 TGTCAGATGATGTAAGTGGCCGG + Intergenic
1019916528 7:4136636-4136658 TGTCAGCTGGTGGGTGAGGGAGG - Intronic
1020068993 7:5213104-5213126 TGACAGATCCTGGAAGACGGTGG + Intronic
1022441469 7:30436687-30436709 TGTCCCTTGCTGGTAGAGGGAGG - Intronic
1023214432 7:37847082-37847104 TTCCAGATGCTGCAAGTGGGAGG + Intronic
1024390183 7:48801039-48801061 TGCCAGAGGCAGGGAGAGGGTGG + Intergenic
1024903422 7:54348797-54348819 TGTCGGATGAGGAAAGAGGGTGG + Intergenic
1026118026 7:67512659-67512681 TGGCAGCTTCTGGAAGAGGCGGG - Intergenic
1026243928 7:68601417-68601439 TGCCAAAAGCTGGAAGAGAGAGG + Intergenic
1028571728 7:92295943-92295965 AGTCTGATGCTGGAAGAGAAAGG + Intronic
1028757304 7:94452517-94452539 TCTCAGGAACTGGAAGAGGGAGG + Intergenic
1031146619 7:118003949-118003971 TGTTAGATGCTGATAGAGTGGGG - Intergenic
1031893094 7:127317957-127317979 TGTCAGAGGCTGGAGGAGGAGGG + Intergenic
1033099710 7:138460162-138460184 CCTCAGTTGCTGGGAGAGGGAGG + Intergenic
1033551327 7:142450991-142451013 TGGCAGATGCTGCATGACGGAGG - Intergenic
1034529852 7:151688928-151688950 TCTCAGAAGATGGAACAGGGAGG - Intronic
1034874075 7:154709829-154709851 TGTCAGAAACTGGATGATGGTGG - Intronic
1035269859 7:157712872-157712894 TGTCAGGTGCTGGCAGAGGCTGG + Intronic
1035269863 7:157712882-157712904 TGGCAGAGGCTGGAGGAGGAGGG + Intronic
1035908739 8:3542518-3542540 TGTCAGATGCTGGCAGGGACTGG + Intronic
1037411574 8:18604092-18604114 AATCAGAGGTTGGAAGAGGGTGG + Intronic
1038397036 8:27254476-27254498 TGTCAGAGGCGGGTGGAGGGAGG - Intronic
1039856178 8:41416276-41416298 AGTCAGAGGCTGGCAGAGGTGGG + Intergenic
1042906800 8:73780209-73780231 CATCAGAGGCTGGAAGAGGCAGG - Intronic
1043303315 8:78762321-78762343 TGCCAGATGCCAGAAGTGGGTGG - Intronic
1043750165 8:83925252-83925274 TGTCCCATGCTGAAAGTGGGGGG + Intergenic
1046249579 8:111612179-111612201 TGCCTGATGCCGGCAGAGGGAGG + Intergenic
1047672085 8:127159004-127159026 TTTCAGTTGCTGGAAGAGCATGG + Intergenic
1048088635 8:131213590-131213612 TGTCAGATGCTGGATGACAGAGG + Intergenic
1048486040 8:134848334-134848356 TGGCAGATACTGGAGGAGGGAGG - Intergenic
1048718771 8:137298708-137298730 TGCCACATGCTGGAATAGAGGGG - Intergenic
1049183891 8:141238661-141238683 TGGTGGATGCTGGAAGAGGCTGG - Intronic
1049889846 9:58536-58558 TGCCAGAAGCTGGAAGAGGCAGG + Intergenic
1050013410 9:1208393-1208415 GGTCAGACACTGGATGAGGGAGG + Intergenic
1050235220 9:3570822-3570844 TGTCAGTAGCTAGAAGAAGGTGG + Intergenic
1050237989 9:3603142-3603164 TGTCATATGCAGGAAGAGGAAGG - Intergenic
1050967632 9:11827196-11827218 TGTCAGAGGCTGGGAAAGGTAGG + Intergenic
1052313834 9:27096229-27096251 TGTCACATGGTGAGAGAGGGAGG - Intergenic
1053096179 9:35329858-35329880 TGGCAGAAGAGGGAAGAGGGTGG + Intronic
1053620400 9:39809113-39809135 TGTAAGATGCTGGGAGGAGGTGG - Intergenic
1053626300 9:39874821-39874843 TGTAAGATGCTGGGAGGAGGTGG + Intergenic
1053628811 9:39908081-39908103 CCTCACATGGTGGAAGAGGGAGG - Intergenic
1053731325 9:41059811-41059833 TGCCAGAAGCTGGAAGAGGCAGG + Intergenic
1053777257 9:41558263-41558285 CCTCACATGGTGGAAGAGGGAGG + Intergenic
1053878569 9:42568412-42568434 TGTAAGATGCTGGGAGGAGGTGG - Intergenic
1053894097 9:42725966-42725988 TGTAAGATGCTGGGAGGAGGTGG + Intergenic
1054215076 9:62342621-62342643 CCTCACATGGTGGAAGAGGGAGG + Intergenic
1054217588 9:62375880-62375902 TGTAAGATGCTGGGAGGAGGTGG - Intergenic
1054233121 9:62533283-62533305 TGTAAGATGCTGGGAGGAGGTGG + Intergenic
1054263756 9:62898330-62898352 TGTAAGATGCTGGGAGGAGGTGG + Intergenic
1054364475 9:64320223-64320245 CCTCACATGGTGGAAGAGGGAGG - Intergenic
1054672405 9:67812728-67812750 CCTCACATGGTGGAAGAGGGAGG - Intergenic
1054697182 9:68372278-68372300 TGCCAGAAGCTGGAAGAGGCGGG - Intronic
1055555011 9:77464996-77465018 TGCCAGAAGTTGAAAGAGGGAGG + Intronic
1057134579 9:92678576-92678598 TGCCAGAGGCTGGGGGAGGGAGG + Intergenic
1057879800 9:98784576-98784598 TTTCAGATGCAGGAAGAGCTAGG + Intronic
1058931303 9:109721859-109721881 TGACAGATGATGGAAGAGGAAGG - Intronic
1058982985 9:110187316-110187338 TGCCAGAAGCTGGAAGTGAGGGG - Intergenic
1059331415 9:113538022-113538044 TGCCAGTTGGTGGTAGAGGGTGG - Intronic
1060074206 9:120577407-120577429 TGTCAGAGGCTGGGAGAAGGGGG + Intronic
1060289931 9:122292558-122292580 TGTGAAATGCAGGGAGAGGGTGG + Intronic
1060298451 9:122359376-122359398 TACCAGAGGCTGGGAGAGGGAGG - Intergenic
1061246421 9:129403147-129403169 TGCCAGATCGGGGAAGAGGGAGG - Intergenic
1061443181 9:130620977-130620999 TGTCAGATGCTGGGGGAAGGAGG + Intronic
1062125451 9:134858368-134858390 TGTCAGATGCTAGAAGTCTGAGG - Intergenic
1062357857 9:136173517-136173539 CATCAGAAGCTGGAAGAGGCAGG + Intergenic
1185611615 X:1396667-1396689 TATCAGATGCTGGCAGAGAAGGG - Intergenic
1185616907 X:1427552-1427574 TGTCAGGAGCTGGGAGAGGCAGG + Intronic
1185884339 X:3769002-3769024 TATCAGATGCTGGAAGTTTGAGG - Intergenic
1187485752 X:19701547-19701569 TGTTAGGTGCTGGAGGAAGGAGG - Intronic
1189044953 X:37580714-37580736 TGCCAGAAGCTGGAGGTGGGTGG - Intronic
1189431514 X:40951342-40951364 TGGCAGAGGTTGGAAGAGTGTGG - Intergenic
1189675145 X:43453753-43453775 TGTCACATGCAGGAAGAGACAGG - Intergenic
1192212800 X:69138281-69138303 TATCCGATGCTGGAGGATGGGGG - Intergenic
1192696136 X:73417882-73417904 AGGCAGAGGCTGGAAGAGTGTGG - Intergenic
1193257053 X:79361665-79361687 TTTCAGAGGGTGGAAGATGGGGG - Intronic
1193965056 X:87975043-87975065 TGGCAGAGGCTGGAAGAGTGTGG + Intergenic
1194136354 X:90148703-90148725 TGCCAGGTGCTGGAGGAAGGAGG - Intergenic
1195615984 X:106912179-106912201 AGGCTGAGGCTGGAAGAGGGAGG - Intronic
1195737059 X:108022909-108022931 TGTCACATGGTGAGAGAGGGAGG - Intergenic
1195993091 X:110702663-110702685 TGTCAAATGATGGAACTGGGAGG + Intronic
1196546782 X:116972783-116972805 TGGCAGAGGTTGGAAGAGTGTGG + Intergenic
1197694508 X:129536658-129536680 TTTAAGATGCTAGAAGAGAGAGG - Intergenic
1197728900 X:129794055-129794077 TGTCAGTCGCTGGTGGAGGGCGG - Exonic
1198490545 X:137135930-137135952 TGTATGAAGCTGGAAGAGGTTGG - Intergenic
1200482112 Y:3718763-3718785 TGCCAGGTGCTGGAGGAAGGAGG - Intergenic