ID: 916290068

View in Genome Browser
Species Human (GRCh38)
Location 1:163155833-163155855
Sequence CTTTCTAGAGAGTGGATGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916290068_916290076 23 Left 916290068 1:163155833-163155855 CCAGGCATCCACTCTCTAGAAAG 0: 1
1: 0
2: 2
3: 11
4: 170
Right 916290076 1:163155879-163155901 TGGTCTTATGGAAACACTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 153
916290068_916290074 11 Left 916290068 1:163155833-163155855 CCAGGCATCCACTCTCTAGAAAG 0: 1
1: 0
2: 2
3: 11
4: 170
Right 916290074 1:163155867-163155889 CACCTGATTATCTGGTCTTATGG 0: 1
1: 0
2: 1
3: 8
4: 162
916290068_916290071 3 Left 916290068 1:163155833-163155855 CCAGGCATCCACTCTCTAGAAAG 0: 1
1: 0
2: 2
3: 11
4: 170
Right 916290071 1:163155859-163155881 ATGAAACCCACCTGATTATCTGG 0: 1
1: 0
2: 1
3: 17
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916290068 Original CRISPR CTTTCTAGAGAGTGGATGCC TGG (reversed) Intronic
900413767 1:2525891-2525913 CTCTCTGGAGAGTGGACGCCGGG - Intronic
901119135 1:6876030-6876052 TATTCTACAGGGTGGATGCCAGG - Intronic
902454440 1:16521885-16521907 ATTTCTATAGGGTGGAGGCCTGG + Intergenic
902498013 1:16888439-16888461 ATTTCTATAGGGTGGAGGCCTGG - Intronic
902542914 1:17167056-17167078 CTCTGCAGGGAGTGGATGCCAGG - Intergenic
904600035 1:31668127-31668149 CTTGCTGGGGAGTGGGTGCCAGG - Intronic
905158231 1:36007061-36007083 CTTTCTATTGAGTAGAGGCCAGG - Intronic
908096651 1:60746505-60746527 GTTTCTGGAGAGGGGCTGCCAGG + Intergenic
909931317 1:81502929-81502951 CTTTCCTGAGAGTGGTTGCTGGG - Intronic
911983336 1:104593512-104593534 CTTCCTAGAGAGTGGTTGAATGG + Intergenic
913655225 1:120953541-120953563 ATTTCTATAGGGTGGAGGCCTGG + Intergenic
914645410 1:149647702-149647724 ATTTCTATAGGGTGGAGGCCTGG + Intergenic
914691759 1:150035505-150035527 TTTTCTAGAGACTGGAACCCAGG - Intergenic
914985093 1:152449676-152449698 CTTGCTAGAGATGGGATGACAGG - Intergenic
916071210 1:161171116-161171138 CTGTATAGAGAGTGGGCGCCAGG + Exonic
916290068 1:163155833-163155855 CTTTCTAGAGAGTGGATGCCTGG - Intronic
916618499 1:166470687-166470709 CTTTCCAGAAACTGGATGCAGGG - Intergenic
917594868 1:176518952-176518974 CGTTCTAGAGAGTGGAGACCAGG + Intronic
919718495 1:200806486-200806508 CTTTCTAGAGAGTAGATTAATGG + Intronic
919849783 1:201664866-201664888 CTTTCTAGAGATGGCAGGCCTGG - Intronic
920618727 1:207522670-207522692 CTTTCTTGAGGGTGGATGGTTGG + Intronic
922194263 1:223346113-223346135 CTGTCTAGAGGGTGGAGACCAGG - Intronic
923507850 1:234621720-234621742 CTTTCTGGAGAGTGGAAGACTGG + Intergenic
924585433 1:245357253-245357275 TTTTCTTGAGAGTGGACTCCAGG + Intronic
1063550839 10:7031195-7031217 CCTGCTAGACAGTGGAAGCCCGG + Intergenic
1066573061 10:36793925-36793947 CTTTCTAGAGGGTGGGTACAGGG + Intergenic
1067165559 10:43863987-43864009 CTTTCTAAAGAGGGAAGGCCAGG - Intergenic
1068052697 10:51971916-51971938 ATATCTAGATAGTGGATTCCTGG - Intronic
1068437145 10:57007241-57007263 CTTTCAAAAGAGTGGCTTCCAGG - Intergenic
1069722202 10:70556968-70556990 CTTTCTAGTGAGTGGATGGAGGG + Intronic
1072137881 10:92564244-92564266 CTTGCTACAGAATGGTTGCCTGG - Intronic
1073149679 10:101303264-101303286 CTATCTAGAGAAGGGATGGCAGG - Intergenic
1073341979 10:102752136-102752158 GTATCTAGTGAGTGGAGGCCAGG + Intronic
1074045279 10:109832340-109832362 ATTTCTAGAGTATGGATCCCAGG + Intergenic
1074195620 10:111182103-111182125 CTATCTATAGGGTGAATGCCTGG - Intergenic
1074700503 10:116087952-116087974 CTTTGGAGAGAGTAAATGCCCGG + Intronic
1079670005 11:23157107-23157129 CTTTCTAGACATTGGCTGTCAGG - Intergenic
1079687675 11:23381126-23381148 ATTTCAAGATAGTGGAAGCCAGG + Intergenic
1080565859 11:33508797-33508819 GTTTGAAGAGAGTGGAAGCCTGG + Intergenic
1081673227 11:44953342-44953364 CTTTCTGGAGAGCGGATGCAGGG - Intergenic
1082654264 11:55833996-55834018 CTAACTAGAGTGTGGATTCCTGG - Intergenic
1087908706 11:103727918-103727940 CTTTCTAGAGACTTGTTGCATGG - Intergenic
1087934261 11:104013607-104013629 CTTCCAATAGAGTGGATGCCTGG + Intronic
1088192235 11:107239000-107239022 CATTGTAGAGAGTGGATGTAAGG - Intergenic
1088709347 11:112493099-112493121 ATTTCTATTGAGTGCATGCCAGG - Intergenic
1090385316 11:126355055-126355077 CTTCCTGGAGACAGGATGCCTGG + Intergenic
1091911427 12:4233427-4233449 CTTTCCAGAGAATGGCTTCCTGG - Intergenic
1095906175 12:47380327-47380349 CTTTCTGGAGGGTGGGTGCAGGG - Intergenic
1098195812 12:68000980-68001002 CTTTATAGAGTAAGGATGCCAGG - Intergenic
1101058814 12:100949226-100949248 GTTTCTAGAGGGTGGAAGTCAGG - Intronic
1107803155 13:44129577-44129599 CTTTCTGGAGAGAGGCTGCCAGG - Intergenic
1110098123 13:71557582-71557604 CTTTGTAGATAGTGAGTGCCTGG - Intronic
1114302697 14:21392679-21392701 CTGTCTAGCAAGTGGTTGCCTGG + Exonic
1114851440 14:26386890-26386912 ATTTCTGGAGAGTGGGTGCAGGG - Intergenic
1115013787 14:28585032-28585054 CCTTCTTGAGGGTGGATGCTGGG - Intergenic
1117050525 14:51855329-51855351 CTTTCTGGAGAGAGAGTGCCTGG - Intronic
1119990947 14:79196591-79196613 CATTCTACAGAGTGGATGTTTGG - Intronic
1121468168 14:94129288-94129310 CGTTCTAGAGAGAGAGTGCCAGG + Exonic
1123469618 15:20540679-20540701 CTCTCTGGAGAGTAGAAGCCTGG + Intronic
1123648444 15:22460020-22460042 CTCTCTGGAGAGTAGAAGCCTGG - Intronic
1123682868 15:22775401-22775423 CTCTCTGGAGAGTAGAAGCCTGG + Intronic
1123723886 15:23083479-23083501 CTTCCTTGATAATGGATGCCAGG - Intergenic
1123729896 15:23135665-23135687 CTCTCTGGAGAGTAGAAGCCTGG + Intronic
1123748066 15:23333147-23333169 CTCTCTGGAGAGTAGAAGCCTGG + Intergenic
1123762834 15:23446214-23446236 CTCTCTGGAGAGTAGAAGCCTGG + Intronic
1124280430 15:28356999-28357021 CTCTCTGGAGAGTAGAAGCCTGG + Intergenic
1124302268 15:28554613-28554635 CTCTCTGGAGAGTAGAAGCCTGG - Intergenic
1124334613 15:28847924-28847946 CTCTCTGGAGAGTAGAAGCCTGG + Intergenic
1127473948 15:59314713-59314735 GTATCTAGTGAGTGGATACCAGG + Intronic
1127927742 15:63563455-63563477 CCTTCTGGAGAGTGCATCCCAGG - Intronic
1128083523 15:64870731-64870753 CTTTGAAGAGAGTGGCTGCTGGG + Intronic
1128358521 15:66944572-66944594 CTGTCTACAGAGTGGATGTGAGG + Intergenic
1128818795 15:70633865-70633887 CTATCTAGAGAGTAGAGCCCAGG + Intergenic
1129036933 15:72655692-72655714 CTCTCTGGAGAGTAGAAGCCTGG - Intronic
1129212954 15:74081533-74081555 CTCTCTGGAGAGTAGAAGCCTGG + Intronic
1129294281 15:74591412-74591434 CTTTCCTGAGAGTGGTTGCTGGG - Exonic
1129397448 15:75259553-75259575 CTCTCTGGAGAGTAGAAGCCTGG - Intronic
1129401057 15:75283830-75283852 CTCTCTGGAGAGTAGAAGCCTGG - Intronic
1129474661 15:75776540-75776562 CTCTCTGGAGAGTAGAAGCCTGG - Intergenic
1129730090 15:77925849-77925871 CTCTCTGGAGAGTAGAAGCCTGG + Intergenic
1129838427 15:78728138-78728160 CTCTCTGGAGAGTAGAAGCCTGG - Intergenic
1132115214 15:99131063-99131085 CTTTCCAGTGAGTGGAACCCAGG - Exonic
1136664996 16:31802924-31802946 GTTTCTAGAATGTGGGTGCCTGG - Intergenic
1137441069 16:48498793-48498815 CTTTCTATAGGGAGGATACCAGG + Intergenic
1144853400 17:18255293-18255315 CCTTCCTGAGAGTGGAAGCCAGG - Intronic
1145119548 17:20245363-20245385 CTGTCTACATAGTGAATGCCCGG + Intronic
1147312235 17:39602221-39602243 CACTCTAGAGAGGCGATGCCGGG + Intergenic
1150877079 17:68982318-68982340 GTTTCTAGTGGGTGGAGGCCAGG - Intronic
1151508326 17:74543515-74543537 AGATCTAGAGAGGGGATGCCCGG + Intronic
1153566448 18:6423084-6423106 CTGTATATAGAGTGCATGCCAGG + Intergenic
1156937071 18:42722513-42722535 CCTACTAGAGAGGGGTTGCCTGG + Intergenic
1165167131 19:33864530-33864552 CTGTCTACAGGGTGGAAGCCAGG + Intergenic
1166190466 19:41173212-41173234 CTTTATGCAGAGTTGATGCCAGG - Intergenic
928086298 2:28348325-28348347 CTGTCTAGTGGGTGGGTGCCAGG - Intergenic
928198320 2:29230571-29230593 CTTGCTAGAAAGAGGAAGCCAGG + Intronic
931046198 2:58356350-58356372 GTTTCTAGTGGGTGGAAGCCAGG - Intergenic
937438421 2:121897611-121897633 CTTTGGAGAGAGAGGATGCATGG + Intergenic
938677295 2:133650910-133650932 CTTTCTAGATTGTGTATTCCTGG - Intergenic
938816217 2:134907038-134907060 CTTTCTGGACAGTGAATGCAGGG + Intergenic
943639350 2:190342571-190342593 CTTGCTAGTGAGTGAAAGCCAGG + Intronic
1169764344 20:9132920-9132942 TTTTCTAGTGAGTAGAAGCCAGG + Intronic
1170353434 20:15467055-15467077 CTTTCTCCTGAGTGGATGTCAGG - Intronic
1171340418 20:24422727-24422749 CGTCCTAGAGAGTGGCTGTCTGG + Intergenic
1173878681 20:46394059-46394081 CTTCCTTGATAATGGATGCCAGG + Exonic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1175639145 20:60612486-60612508 CTTTCTAGGGATTGGATGGCTGG - Intergenic
1177218832 21:18164312-18164334 CTTTCTTGAGATTGAATTCCTGG - Intronic
1183501122 22:38180031-38180053 CTTTGTAGAGGGTGGCTCCCTGG - Intronic
952943617 3:38461079-38461101 CTCTCTCGAGTGTTGATGCCAGG + Intronic
954835494 3:53463534-53463556 CTTTCTTGAGAAAGGATGCATGG + Intergenic
955047699 3:55375501-55375523 CTGTCTAGTGAGTAGAAGCCAGG + Intergenic
955076050 3:55614306-55614328 GATTCTAAAGAGTGGAAGCCAGG + Intronic
956718271 3:72097394-72097416 ATTTCTAGAGAATGTATGCTGGG + Intergenic
957945562 3:87058328-87058350 CTTTCTAGAGACTGGTTGAATGG - Intergenic
962412084 3:135150101-135150123 CTTTCCAGAGAGTAGAGGCAAGG + Intronic
965222848 3:165950389-165950411 TTTTCTAGAGAGAGGATGCGAGG + Intergenic
965391734 3:168112539-168112561 CTTTCTAGAGAGAGTATGGAAGG + Intergenic
967398985 3:189040049-189040071 CTTTCTATAGAGGCTATGCCTGG + Intronic
967418288 3:189243916-189243938 CTTTCTAGAGACTGGCTGAGTGG - Intronic
968771494 4:2510438-2510460 CTTTCTAGGGAGGAGAGGCCTGG + Intronic
968955305 4:3715998-3716020 CTTCCTGGGGAGTTGATGCCAGG + Intergenic
975573943 4:75844510-75844532 CCTTCTAGGAAGTGGATTCCTGG + Intergenic
976582943 4:86761428-86761450 ATTTCTAGAGGTTAGATGCCTGG + Intronic
977923915 4:102677197-102677219 TTTTCTAGAGAATGTCTGCCAGG - Intronic
981578341 4:146227984-146228006 CTTTTTAGAGAGTGAGTCCCTGG - Intronic
982108110 4:152028931-152028953 CTATCTAGTGAGTAGAGGCCAGG - Intergenic
982116813 4:152104999-152105021 CTTTGCTGAGAGTGTATGCCAGG - Intergenic
986393467 5:7305935-7305957 CTCTCTGGAGAGTAGAAGCCTGG + Intergenic
987040315 5:14056001-14056023 GTATCTAGTGAGTGGAGGCCAGG + Intergenic
987228353 5:15867283-15867305 TCTTCTAGAGAGAGGAAGCCTGG - Intronic
991494952 5:67217621-67217643 CCTTATAGAGAGTGGTTTCCAGG - Intergenic
994574545 5:101560808-101560830 CTTTCTAGAAAGAGCCTGCCTGG + Intergenic
998766878 5:145498092-145498114 CTCTCTAGAGAATGCATGGCTGG - Intronic
1000158426 5:158575117-158575139 GTGTCTAGTGAGTAGATGCCAGG - Intergenic
1000160726 5:158595053-158595075 CTTTTTAGAGACTGTCTGCCTGG + Intergenic
1001157098 5:169282075-169282097 CTTTCTGTAGAGAGGATGCAAGG - Intronic
1002048707 5:176556885-176556907 GCTTCTAGAGAGTGGATACTGGG - Intronic
1003380441 6:5620154-5620176 CTATCTAGTGAGTAGAGGCCGGG - Intronic
1006756980 6:36424698-36424720 CTTTCTAAAAAATGGATACCAGG + Intronic
1007440643 6:41856637-41856659 ATTTCTGAAGAGAGGATGCCAGG + Intronic
1007877410 6:45121288-45121310 TTTTCTAGAGAGAGAATGCTTGG + Intronic
1008217758 6:48816109-48816131 CTTTCAAAAGACTGGAAGCCTGG + Intergenic
1008421924 6:51311044-51311066 CTTTCTACAGAGTGGGACCCTGG - Intergenic
1010005445 6:70990887-70990909 CTTTCTAGAGAGTTGCTGAATGG + Intergenic
1011433184 6:87309745-87309767 CTTTCTAGAGGGTGGATGCAGGG - Intronic
1011895172 6:92216430-92216452 CTTTCTAGAGAGTGGTCGAATGG + Intergenic
1012585910 6:100922375-100922397 CTTTCTTGAGAGTGGAGGGTGGG + Intergenic
1012921192 6:105222591-105222613 CTTTCTAAACAGTTTATGCCAGG + Intergenic
1013925178 6:115463693-115463715 CTTTCTAGAGATTTGTTGCATGG + Intergenic
1014917109 6:127164124-127164146 CTTTCGTGAGATTGGATGCAGGG - Intronic
1015251323 6:131131184-131131206 CTTTCTGGAGGGTGGATGCGAGG - Intergenic
1015802870 6:137078304-137078326 ATCTCTAGAGAGTGGAAGCATGG - Intergenic
1017697930 6:157037450-157037472 CTTTCTAGGAGGTGGATCCCTGG + Intronic
1020370295 7:7424702-7424724 CTTTTGAGAGAGTGGGTGCAGGG - Intronic
1021931240 7:25583263-25583285 CATTGCAGAGTGTGGATGCCAGG + Intergenic
1023207825 7:37770174-37770196 CTTTCAAAAGTGTGGATGCCCGG + Intronic
1031549558 7:123091483-123091505 CTTTCTGAAGAGAGCATGCCAGG + Intergenic
1031850124 7:126853449-126853471 CCTTCTAGAGACAGGAAGCCTGG + Intronic
1032991650 7:137401013-137401035 AGTTACAGAGAGTGGATGCCAGG + Intronic
1033508910 7:142034881-142034903 CTTTCTAGAATGAGGTTGCCTGG - Intronic
1034314106 7:150113754-150113776 CTTTCTAAACAGTCTATGCCTGG + Intergenic
1036207151 8:6813838-6813860 CACTCCTGAGAGTGGATGCCTGG - Intronic
1037893684 8:22637553-22637575 CTCTCAAGAGAGTTGATACCCGG - Intronic
1042679630 8:71368428-71368450 GCTTGTAGAGAGTGGATGCAGGG + Intergenic
1045073009 8:98530309-98530331 CTTTTCAGAGAGTGGAGGCTGGG - Intronic
1046303079 8:112323801-112323823 CTTTGTACAAAGTGGATTCCAGG - Intronic
1046884339 8:119347092-119347114 CTATGGAGAGAGTGGTTGCCAGG - Intergenic
1046890306 8:119415396-119415418 ATTTCTTGAAAGCGGATGCCCGG + Intergenic
1048334038 8:133490034-133490056 ATTTCTTGTGTGTGGATGCCTGG + Intronic
1048922318 8:139242354-139242376 CTCACTATAGAGTGGATGGCAGG + Intergenic
1051068307 9:13131696-13131718 CTTTCTAGAGGGTGGATGCTGGG + Intronic
1051734603 9:20185789-20185811 GTTTGTAGAGACTGGAAGCCAGG + Intergenic
1052794831 9:32913874-32913896 CTGTCTGGAGAATGGATGTCAGG - Intergenic
1056432586 9:86542702-86542724 ATCTCTAGAGGGTGGATGGCTGG + Intergenic
1060088244 9:120720741-120720763 CATTGTGGAGAATGGATGCCGGG + Intergenic
1061065395 9:128275037-128275059 CTCTCTGGAGAGTAGAAGCCTGG + Intronic
1061296720 9:129680755-129680777 CCTTCCAGAGAGGGGATCCCAGG - Intronic
1061333311 9:129911525-129911547 ATTCTTAGAGAGTGGCTGCCCGG + Intronic
1185493715 X:538452-538474 CCTTCTAGATGCTGGATGCCAGG + Intergenic
1185632875 X:1528352-1528374 CTTGCTGGAGAGTGGGTTCCTGG + Intronic
1186989620 X:15053309-15053331 AGTTCTAGAGAGGGGAAGCCAGG - Intergenic
1188891921 X:35622342-35622364 CTTTCTGGAGAGTAGGTGCTGGG + Intergenic
1197962193 X:132019307-132019329 GCATCTAGAGAGTGGAGGCCAGG - Intergenic
1198420569 X:136467646-136467668 CTTTTTAAAGCGTGGATGCTAGG + Intergenic