ID: 916290771 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:163164051-163164073 |
Sequence | GAAATGTGCAGAGCCCGCTT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 81 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 74} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
916290767_916290771 | -1 | Left | 916290767 | 1:163164029-163164051 | CCAAGATTAAATTCCTGAAAAGG | 0: 1 1: 0 2: 1 3: 29 4: 236 |
||
Right | 916290771 | 1:163164051-163164073 | GAAATGTGCAGAGCCCGCTTGGG | 0: 1 1: 0 2: 0 3: 6 4: 74 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
916290771 | Original CRISPR | GAAATGTGCAGAGCCCGCTT GGG | Intronic | ||