ID: 916290771

View in Genome Browser
Species Human (GRCh38)
Location 1:163164051-163164073
Sequence GAAATGTGCAGAGCCCGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916290767_916290771 -1 Left 916290767 1:163164029-163164051 CCAAGATTAAATTCCTGAAAAGG 0: 1
1: 0
2: 1
3: 29
4: 236
Right 916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916290771 Original CRISPR GAAATGTGCAGAGCCCGCTT GGG Intronic
903562217 1:24236541-24236563 GGAATGTGAAGGGCCCGCCTCGG - Intergenic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
916324228 1:163539294-163539316 TGAATGTGCAGAGCTCACTTGGG + Intergenic
920272686 1:204778105-204778127 GAAATGTGCAGACCTTGCTGAGG - Intergenic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
923492582 1:234497564-234497586 GAAAGGTGCAGAGCCCCTATAGG + Intergenic
1063028436 10:2207341-2207363 GAAATGTGCAGAGCCAGGACAGG - Intergenic
1063829815 10:9940122-9940144 GAAGTGTGCAGAGGCAGATTGGG + Intergenic
1066014005 10:31219970-31219992 GAAATGTGCAGAGCCCCAAAGGG + Intergenic
1074553437 10:114466554-114466576 GGTATGGGCAGAGCCTGCTTCGG + Intronic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1083870212 11:65482767-65482789 GAAATGTGCAGATTCCACTTAGG + Intergenic
1084798426 11:71525121-71525143 GAAATTTTCAGAGCCCCCTAGGG - Intergenic
1090744843 11:129697306-129697328 GAAATGTGCAGAGCTTACTGTGG + Intergenic
1091582761 12:1799076-1799098 GAACTGAGCAGAGCCCGCTGAGG + Intronic
1093608818 12:21128819-21128841 GGAATGTGCAGAGCCCTGTGGGG + Intronic
1103367612 12:120394638-120394660 GGATTGTGCAGACCCAGCTTTGG + Intergenic
1104483090 12:129125761-129125783 GAAATGTTCACAGTGCGCTTTGG - Intronic
1107823148 13:44304520-44304542 CAAATGTGCAGGGCTGGCTTCGG - Intergenic
1108605297 13:52031187-52031209 GCAATGTGCTGAGCCAGTTTTGG - Exonic
1108676458 13:52741065-52741087 GAAATGTCCTGAGCCTGCATTGG + Intergenic
1109817497 13:67604416-67604438 GAAATCTGATGGGCCCGCTTTGG - Intergenic
1119605489 14:76012626-76012648 GAAATGAGCACAGCCTGCTGGGG - Intronic
1121951923 14:98178499-98178521 GCAATCTGCAGATCCCACTTTGG - Intergenic
1125438963 15:39680564-39680586 GAAATGGTCAGAGCCATCTTAGG + Intronic
1126950114 15:53871447-53871469 TAAATGAGCAGAGCCTGCTGTGG - Intergenic
1130907293 15:88249637-88249659 GAAATGGGAAGAGCCTCCTTGGG + Intronic
1139080404 16:63511683-63511705 GAAATGTTCATAGCAGGCTTTGG - Intergenic
1139674984 16:68517467-68517489 GAATTGTTCAGTGCCTGCTTGGG - Intergenic
1141862246 16:86725783-86725805 ATAATGTGCACAGCCCTCTTTGG + Intergenic
1157689200 18:49667194-49667216 GAAATGTCCAGAGCCAGCACCGG - Intergenic
1158195874 18:54884451-54884473 GTAATGTGCATTGGCCGCTTTGG + Intronic
1159032399 18:63244779-63244801 GAAACTTTCAGAGCCCGCTTTGG + Intronic
1159830460 18:73271905-73271927 GAAAGGTGCAGAGTCAACTTTGG + Intergenic
1167494600 19:49810191-49810213 GAAAGGGGCAGAGCCAGCTCTGG + Intronic
928186666 2:29116036-29116058 GAAATGGGAAGAGGCCGCGTTGG - Intronic
932798139 2:74715541-74715563 GAAATGTGCAGAGCCGGCCCTGG - Intergenic
933731128 2:85457000-85457022 GAAGTGGTCAGAGCCCTCTTTGG - Intergenic
934035078 2:88082473-88082495 GACAGGTGCAGAGCCAGCTGAGG - Intronic
934714773 2:96537145-96537167 GAAATATGCCGAGCCCGGTACGG + Intronic
935935463 2:108177718-108177740 GAAGTGTGCACACCCTGCTTTGG + Intergenic
938113260 2:128584684-128584706 GAAATGTTCAGAGTGTGCTTGGG + Intergenic
938590846 2:132734861-132734883 GAACTGAGCAGAGCCCACTTTGG - Intronic
941889741 2:170567435-170567457 GAAATGTTTAAAGCCCTCTTTGG + Intronic
945335213 2:208583820-208583842 GACATTTGCAGAGACTGCTTGGG - Intronic
948462654 2:238137862-238137884 GAAATGTCCAGTGGCCTCTTGGG + Intergenic
1168998978 20:2153202-2153224 AAATGCTGCAGAGCCCGCTTTGG + Intronic
1171266665 20:23776626-23776648 GAAAAGTGCAGGGCCCTCCTGGG + Intergenic
1174134242 20:48367950-48367972 GAGCTGGGCAGAGCCCGCCTCGG - Intergenic
1179662894 21:42889394-42889416 GAAATGTGTAGAGCCAGCCTGGG - Intronic
953108141 3:39906034-39906056 CATATGTGCAGAGCATGCTTTGG + Intronic
956700456 3:71954478-71954500 GAAATGTGCTGAGTCTGTTTGGG - Intergenic
966327060 3:178768680-178768702 GAAATGGGCAGAGCTCCTTTAGG - Intronic
969137899 4:5045201-5045223 GAGAGGTACAGAGCCCGCTCAGG - Intergenic
971073216 4:23118500-23118522 AAAATGGGCAGAGACGGCTTTGG + Intergenic
975090395 4:70395184-70395206 GAAATGTGCTGCCCCTGCTTTGG + Intergenic
978464558 4:108994467-108994489 CAAATGGGCAGAGCCCACTGCGG + Intronic
986231273 5:5866769-5866791 GCCATGTGCAGAGCCCGGTCTGG + Intergenic
988391527 5:30639879-30639901 GAAATTTGCAGAACACGGTTCGG - Intergenic
990867478 5:60396106-60396128 GAAAAGAGCAGTGCCCCCTTTGG - Intronic
992541923 5:77774579-77774601 GAACTGTCCCCAGCCCGCTTTGG + Intronic
995164775 5:109026540-109026562 TAAATGTGCTGAGCCAGCTAGGG + Intronic
995552733 5:113296571-113296593 GGAATGTGCAGAGCGGGCATGGG + Intronic
1001311973 5:170617575-170617597 GAATTGAGCAGAACCAGCTTTGG - Intronic
1003277261 6:4663330-4663352 GAAATGTCCCAAGCCAGCTTAGG + Intergenic
1005249760 6:23930959-23930981 GATTGGTGCAGAGCCCTCTTTGG - Intergenic
1019015678 6:168878194-168878216 GAAATGTCCACACCCAGCTTGGG + Intergenic
1019088090 6:169500821-169500843 GAGCTGTGCAGAGGCTGCTTAGG - Intronic
1024273377 7:47658959-47658981 GAAGTGTTCAGAGCCTGCTGGGG + Exonic
1024570036 7:50715675-50715697 GGAGTGTGCAGACCCAGCTTTGG - Intronic
1028735008 7:94199073-94199095 GAAATGTACAGAGCTTGCCTAGG - Intergenic
1036911022 8:12756351-12756373 CAAAACTGCAGAGCCAGCTTGGG - Intergenic
1037138926 8:15496572-15496594 GAAATGTGCTGAGCCTGGTAAGG - Intronic
1039842727 8:41305339-41305361 GAGAAGTGCAGAGCCCTCCTTGG - Intronic
1049148901 8:141021752-141021774 GATAGGTGCAGAGCCAGGTTTGG + Intergenic
1049786537 8:144453638-144453660 GAAACAGGCAGAGCCAGCTTGGG + Intronic
1054725402 9:68645244-68645266 GAAATGTGCAGATCACGTTAAGG - Intergenic
1058766390 9:108186518-108186540 GAGATGGGCAGAGACCACTTAGG + Intergenic
1061790429 9:133056148-133056170 GAAGAGTTCAGAGACCGCTTTGG - Intronic
1190932844 X:54964173-54964195 AAAATGTGCTAAGCCCACTTGGG + Intronic
1200893715 Y:8352197-8352219 GAAAAGTGCAGAAGCTGCTTAGG - Intergenic