ID: 916290771

View in Genome Browser
Species Human (GRCh38)
Location 1:163164051-163164073
Sequence GAAATGTGCAGAGCCCGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916290767_916290771 -1 Left 916290767 1:163164029-163164051 CCAAGATTAAATTCCTGAAAAGG 0: 1
1: 0
2: 1
3: 29
4: 236
Right 916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916290771 Original CRISPR GAAATGTGCAGAGCCCGCTT GGG Intronic