ID: 916293018

View in Genome Browser
Species Human (GRCh38)
Location 1:163187376-163187398
Sequence GAGTTATGAACCAGGAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 666
Summary {0: 2, 1: 34, 2: 79, 3: 154, 4: 397}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916293018_916293025 21 Left 916293018 1:163187376-163187398 CCACAGTTCCTGGTTCATAACTC 0: 2
1: 34
2: 79
3: 154
4: 397
Right 916293025 1:163187420-163187442 TTTGTGATAATGGGTGTGTTAGG 0: 1
1: 0
2: 0
3: 26
4: 258
916293018_916293026 28 Left 916293018 1:163187376-163187398 CCACAGTTCCTGGTTCATAACTC 0: 2
1: 34
2: 79
3: 154
4: 397
Right 916293026 1:163187427-163187449 TAATGGGTGTGTTAGGCCTCAGG 0: 1
1: 4
2: 24
3: 79
4: 138
916293018_916293024 12 Left 916293018 1:163187376-163187398 CCACAGTTCCTGGTTCATAACTC 0: 2
1: 34
2: 79
3: 154
4: 397
Right 916293024 1:163187411-163187433 TTACAGTCTTTTGTGATAATGGG 0: 1
1: 0
2: 1
3: 14
4: 284
916293018_916293023 11 Left 916293018 1:163187376-163187398 CCACAGTTCCTGGTTCATAACTC 0: 2
1: 34
2: 79
3: 154
4: 397
Right 916293023 1:163187410-163187432 GTTACAGTCTTTTGTGATAATGG 0: 1
1: 2
2: 3
3: 12
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916293018 Original CRISPR GAGTTATGAACCAGGAACTG TGG (reversed) Intronic