ID: 916294899

View in Genome Browser
Species Human (GRCh38)
Location 1:163207476-163207498
Sequence CCAAATATGAAACACTTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916294895_916294899 8 Left 916294895 1:163207445-163207467 CCTAACAGAAATAAATGAGAGCC 0: 1
1: 0
2: 1
3: 32
4: 418
Right 916294899 1:163207476-163207498 CCAAATATGAAACACTTGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 209
916294894_916294899 20 Left 916294894 1:163207433-163207455 CCAATTTAGACTCCTAACAGAAA 0: 1
1: 0
2: 1
3: 44
4: 331
Right 916294899 1:163207476-163207498 CCAAATATGAAACACTTGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916294899 Original CRISPR CCAAATATGAAACACTTGCC AGG Intronic
903729095 1:25477140-25477162 CCAAATGTGAAACACTAACATGG + Intronic
906221051 1:44079702-44079724 CCATATATGAAATATTTTCCAGG - Intergenic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
908781347 1:67693483-67693505 CAAAATATAAAACATTAGCCGGG - Intergenic
909280243 1:73742194-73742216 CCAAATATGGAACAGGGGCCTGG + Intergenic
911516381 1:98873008-98873030 TTAACTATGAAACACTTGCCAGG - Intergenic
913468243 1:119164916-119164938 CCCAATATGAAACAATCTCCTGG + Intergenic
916294899 1:163207476-163207498 CCAAATATGAAACACTTGCCAGG + Intronic
916975362 1:170071729-170071751 CCAAAACTGAAACACCTCCCAGG + Intronic
917330959 1:173879788-173879810 CTAAATATAAAACATTAGCCAGG + Intronic
917683968 1:177396980-177397002 CTAAATATTAAACACTTGTAAGG - Intergenic
917933185 1:179838187-179838209 CTAAAAATGAGACACTAGCCAGG - Intergenic
917940337 1:179913594-179913616 CCATATATTGAACTCTTGCCTGG - Intronic
917977527 1:180250041-180250063 CCAAACATCAAGGACTTGCCGGG - Intronic
918496232 1:185140614-185140636 CAAAATATGAAAAACTTTTCTGG + Intronic
918602843 1:186383876-186383898 AAAAATATGAAAAACTAGCCAGG + Intronic
920139804 1:203800930-203800952 CCAAATATAAAACAATTTCACGG - Exonic
924105647 1:240646395-240646417 CTAAAAATGTAACACATGCCAGG - Intergenic
1063362203 10:5467928-5467950 CCCAACATCAAACACTTCCCAGG + Intergenic
1065041134 10:21697629-21697651 CCAAATAGTTAACACTTGCCTGG + Intronic
1065352905 10:24811556-24811578 CAGAACATGAAACACTTGGCAGG - Intergenic
1065538678 10:26739417-26739439 CAAAATATCAAACTCTTCCCCGG - Intronic
1067991940 10:51224162-51224184 CCAAATCTGTCACACTTGGCAGG - Intronic
1068736932 10:60424362-60424384 ACAAATATGAAAGACTTGATTGG - Intronic
1069228658 10:65977619-65977641 CAAAATATGAAATATTAGCCGGG + Intronic
1069566670 10:69468060-69468082 CCAATTAGGAAAGGCTTGCCTGG + Intronic
1075907420 10:126093674-126093696 TCAAATAAAAAACACTTGCTGGG + Intronic
1077649704 11:3959070-3959092 CCAAATTTGAAAATCTTCCCAGG + Intronic
1078487514 11:11737700-11737722 CAAGATATAAAACATTTGCCTGG - Intergenic
1078504101 11:11917263-11917285 ATAATTAAGAAACACTTGCCTGG - Intronic
1080626831 11:34038119-34038141 AAAAATATGAAAAACTAGCCAGG + Intergenic
1080903815 11:36521118-36521140 CCAAAAATGCAAAATTTGCCAGG - Intronic
1082046777 11:47736078-47736100 ACAAAAAAAAAACACTTGCCAGG + Intronic
1083109659 11:60392958-60392980 AAAAATATGAAAAACTAGCCAGG + Intronic
1083457933 11:62791536-62791558 AGAAATGTGAAACACTGGCCGGG - Intronic
1083896942 11:65624733-65624755 TCAGATATAAACCACTTGCCTGG - Intronic
1084621590 11:70274165-70274187 CCAAAGATGAACCAGATGCCAGG - Intronic
1089355837 11:117852840-117852862 ACAAATATGAAATAATTACCTGG - Intronic
1089718765 11:120391597-120391619 ACAAGGCTGAAACACTTGCCTGG + Intronic
1090577384 11:128120868-128120890 GCACATATGAAACATTTTCCAGG + Intergenic
1091485231 12:880297-880319 CCATATATGTAAAAGTTGCCAGG - Intronic
1092994238 12:13933299-13933321 CAAAAGATGAAACCCTTCCCTGG + Intronic
1094036681 12:26079428-26079450 AAAAATATGAAACATTAGCCAGG + Intronic
1094239423 12:28204703-28204725 CCAAACATGAGACACCTGTCTGG - Intronic
1096373453 12:51087373-51087395 CAAAGTATAAAACACTTCCCAGG - Intergenic
1097876114 12:64645122-64645144 ACAAATATTGAACACCTGCCAGG + Intronic
1103293317 12:119865144-119865166 AAAAATATGAAACATTTCCCTGG + Intronic
1103842542 12:123876800-123876822 AAAAATATGAAACATTAGCCAGG + Intronic
1106944718 13:34814472-34814494 TCAAATATGGAACCCTTGCTAGG + Intergenic
1108760860 13:53562899-53562921 TCAAATAAGAAACACTTGGCTGG + Intergenic
1109307435 13:60656357-60656379 TGAAATATGAAACACTTGTGGGG + Intergenic
1110352382 13:74523793-74523815 ACAAATATGTCACAGTTGCCTGG - Intergenic
1110675357 13:78236499-78236521 CTAAATATGGAAAACATGCCTGG + Intergenic
1111473744 13:88719868-88719890 CCAAATATGAAATATTTGCATGG - Intergenic
1112266236 13:97926263-97926285 ACAAATATAAAAAACTAGCCAGG - Intergenic
1112425731 13:99298840-99298862 CCAAAGCTGCAACCCTTGCCTGG - Intronic
1112808638 13:103191010-103191032 ACAAATATACAACACTTTCCTGG - Intergenic
1115863146 14:37712037-37712059 ACAAAGATGAAGCACTTACCTGG - Intronic
1116292005 14:43056048-43056070 CAAAATTTGAAACACATGCATGG - Intergenic
1116559849 14:46364014-46364036 CGGAAAATGAAACACTTGCATGG - Intergenic
1121057597 14:90872597-90872619 CCTAATACGAAACAATTGACTGG + Intronic
1123213457 14:106783899-106783921 AAAAATATGAAAAACTAGCCAGG - Intergenic
1126366066 15:47895840-47895862 CCAAAAATGCCACACTTGGCTGG - Intergenic
1127346024 15:58099737-58099759 CCAAACATGAAACAAATGCAAGG - Intronic
1129456970 15:75681252-75681274 CCAAATCTGAGCCACTTGCTGGG + Intronic
1133230911 16:4366126-4366148 CCAAATCTGAGCCACGTGCCCGG + Intronic
1133320149 16:4908698-4908720 AAAAATATGAAAAATTTGCCAGG - Intronic
1135475051 16:22766657-22766679 CGAAATCTGGATCACTTGCCAGG + Intergenic
1135856623 16:26017556-26017578 CAAAAAATGAAACACTTTCATGG + Intronic
1136015322 16:27395713-27395735 CCATATATGAAAAACCTGGCTGG + Intergenic
1137924636 16:52528588-52528610 CCACATATGAAGCAGTTGGCCGG - Intronic
1140066097 16:71612472-71612494 CCAAAAAAGAAACTCTCGCCCGG - Intergenic
1141497461 16:84419893-84419915 CCAAATGGGAGAGACTTGCCTGG + Intronic
1142370830 16:89680505-89680527 CCTAATATCAAAAAATTGCCAGG - Intergenic
1142534338 17:603678-603700 GCAAATGTGAAATACTTGCTTGG - Intronic
1142553703 17:757349-757371 CCAAAAATGAAACACCAGCTTGG + Intronic
1143382718 17:6506663-6506685 GCAAATAGAAAACACTGGCCGGG - Intronic
1145093782 17:20008287-20008309 CCAAATAAGAAACCCTGGGCTGG - Intergenic
1145965599 17:28914509-28914531 ACAAATATGAAAAATTAGCCGGG + Intronic
1146370092 17:32260720-32260742 AAAAATATAAAACATTTGCCGGG - Intergenic
1146593975 17:34153958-34153980 CCAAGTATAAAACAATAGCCTGG + Intronic
1149295929 17:55262941-55262963 CCAGACATGAAACTCTTACCAGG - Intergenic
1150541299 17:66102926-66102948 ACAAGTATGAAAAACTAGCCAGG + Intronic
1151800873 17:76378944-76378966 CAAAACTTGAAACACTGGCCAGG + Intronic
1152905805 17:82970297-82970319 GCAAATGTGAAACATCTGCCCGG + Intronic
1158294797 18:55983874-55983896 CCAAATAAAACACTCTTGCCTGG - Intergenic
1159239605 18:65724731-65724753 CCAAATATACAAAAATTGCCGGG - Intergenic
1159392813 18:67815902-67815924 CCAAATGGGAAACAATTACCTGG + Intergenic
1160552991 18:79706960-79706982 CGAAATGAGAAACACTTGCACGG - Intronic
1161674727 19:5639020-5639042 CTAAATAGAAAATACTTGCCAGG - Intronic
1162046163 19:8001842-8001864 CAAAATATCAACCACGTGCCAGG + Intronic
1162388185 19:10373331-10373353 AAAAATATGAAACATTGGCCAGG - Intronic
1162617335 19:11812988-11813010 CCAAAAATAAAAAACTAGCCAGG + Intergenic
1163932123 19:20405837-20405859 CAAAATATGTAACACAGGCCAGG + Intergenic
1163947063 19:20547853-20547875 CAAAATATGTAACACAGGCCAGG + Intronic
1165083561 19:33326515-33326537 CCAAATATGTAAGACCAGCCCGG + Intergenic
927605454 2:24482684-24482706 CCAGAAAGGAAACGCTTGCCTGG + Intergenic
928731881 2:34240877-34240899 CTAAATCTGAACCACTTACCAGG - Intergenic
930441000 2:51405722-51405744 AAAAATATGAAAAATTTGCCAGG - Intergenic
933395854 2:81730141-81730163 CAAAAAAAGATACACTTGCCAGG - Intergenic
933679977 2:85091012-85091034 CAAAAAATAAAACACTAGCCAGG + Intergenic
934556869 2:95291711-95291733 CAAAGCATGAAACATTTGCCAGG + Intergenic
934874765 2:97907213-97907235 CCAAATATTTAACACTGGCATGG - Intronic
936289632 2:111211531-111211553 AAAAATATGAAATACTGGCCAGG - Intergenic
938420314 2:131140730-131140752 CCTCACATGAAACACTTGGCAGG + Intronic
939099209 2:137875590-137875612 CATAAAATGAAACACTTGCATGG - Intergenic
940539847 2:154998938-154998960 CAAAACAAGAAACACTTTCCTGG + Intergenic
940887397 2:159001578-159001600 CCATTTATGAAACCCTTTCCTGG + Intronic
944089486 2:195889954-195889976 ACAGATATGAAACAGTAGCCAGG + Intronic
945661387 2:212689233-212689255 CAAAATATGAAAAATTAGCCAGG + Intergenic
946509361 2:220337807-220337829 CCAATTAAGAAAAACTCGCCAGG - Intergenic
948966453 2:241384427-241384449 CACAATCTTAAACACTTGCCTGG + Intronic
1171190055 20:23152354-23152376 CCAAAGATAAAACCCTGGCCAGG - Intergenic
1173463526 20:43262951-43262973 CCAAATATGAATTTCCTGCCAGG - Intergenic
1174114650 20:48218638-48218660 ACAAAAATCAAACACCTGCCAGG + Intergenic
1174371512 20:50092022-50092044 CCACACATAAAACACTTGGCCGG + Intronic
1177220898 21:18191392-18191414 CCTCATATGAAACAGTTGCCAGG + Intronic
1178218506 21:30628048-30628070 GCAATTTTGAAACAGTTGCCTGG - Intergenic
1183067531 22:35373318-35373340 CAAAATATAAAAAATTTGCCAGG + Intergenic
1183691976 22:39395340-39395362 ACAAATATGAGCCACTTGGCTGG - Intergenic
1183895233 22:40963000-40963022 AAAAATATGAAAAACTAGCCAGG - Intronic
1184824776 22:46942190-46942212 CCTAATACGAACCACATGCCGGG - Intronic
949395790 3:3613705-3613727 CCATAAATGGAACATTTGCCTGG + Intergenic
951000370 3:17552524-17552546 CTAAAAATGGAACACATGCCTGG + Intronic
951499045 3:23363018-23363040 CCAAATATGAAATTCTTGGTTGG - Intronic
953724680 3:45387972-45387994 ACAAGCATGAAACACTTGCCGGG + Intergenic
954529059 3:51302690-51302712 CCAGATATGAAACTCTGGGCTGG + Intronic
958624936 3:96612063-96612085 CCAAATATTAATCACCTACCAGG + Intergenic
959578263 3:107958309-107958331 CCAACTATGGATCACTTTCCTGG + Intergenic
960478411 3:118158920-118158942 CCAAATATTAATCACCAGCCAGG - Intergenic
960592974 3:119382880-119382902 ACAAATTTGAAACAGTTACCAGG - Intronic
960748402 3:120916594-120916616 TGAATTATAAAACACTTGCCAGG - Intronic
961806181 3:129490964-129490986 CCAACTACGAACCACATGCCTGG - Intronic
962029101 3:131580871-131580893 CCACATATAAAACACTGGACAGG + Intronic
963999850 3:151757152-151757174 CCAAGGATGAAGCACTTCCCTGG + Exonic
964165927 3:153705174-153705196 CAAAAAATAAAACACTAGCCTGG - Intergenic
965258714 3:166451589-166451611 AGAAATATGAATCACTGGCCAGG + Intergenic
966631238 3:182077673-182077695 ACAAAAATCAAACACTGGCCAGG + Intergenic
969173529 4:5382686-5382708 CCAAATAAGAAAACCTTGCTCGG - Intronic
969564463 4:7969857-7969879 CCAGAAATGAACCACTTGCGTGG + Intronic
970587353 4:17527226-17527248 CCAGAAAAGAAAAACTTGCCCGG + Intergenic
971038414 4:22721720-22721742 TCAAATATCAAAGACTTCCCAGG - Intergenic
971064829 4:23019430-23019452 GAAAATATGCAAGACTTGCCAGG - Intergenic
971392562 4:26199713-26199735 CCAAAAAGAAACCACTTGCCAGG - Intronic
973270805 4:48261055-48261077 CCAAAGATCAAACTTTTGCCTGG + Intronic
973673825 4:53243349-53243371 CCAGATATGAAACTCTTGGTTGG - Intronic
976754476 4:88483368-88483390 CCAAAAATGAAACAATTAGCTGG - Intronic
978219959 4:106258451-106258473 CAAAATGTGAAACATTAGCCAGG - Intronic
978845099 4:113263981-113264003 CAAAATATGACACATTTGTCAGG - Intronic
979452085 4:120884866-120884888 CAAAAAAAGAAACACTGGCCGGG + Intronic
981850206 4:149220273-149220295 CCAAATATGAAACTCTGGGTTGG - Intergenic
982002989 4:151038116-151038138 CAAAAAATGAAAAAATTGCCTGG - Intergenic
982993353 4:162308049-162308071 ACAAGTATGAAACATTTGCCTGG - Intergenic
985015661 4:185631599-185631621 CTAAATATGAAAAACGAGCCAGG + Intronic
985105568 4:186496354-186496376 TCAAATTTGAAACACGTGACAGG + Intronic
986471716 5:8082685-8082707 AAAAATATGAAAAACTAGCCAGG + Intergenic
988587502 5:32520559-32520581 CAAAATAGGAAGCACTGGCCAGG + Intergenic
988755023 5:34239013-34239035 TGAAATATGAAATTCTTGCCTGG - Intergenic
988906201 5:35792959-35792981 CAAAAAATGAAACACTTTCTAGG + Intronic
993330146 5:86589500-86589522 CCAACTTTGAGACACTTGTCAGG - Intergenic
994790372 5:104217865-104217887 CAAAATACTACACACTTGCCAGG - Intergenic
995837230 5:116410838-116410860 CCTCATATAAACCACTTGCCAGG + Intronic
996347684 5:122504770-122504792 CTACATATAAAACACTTACCTGG + Intergenic
996955227 5:129175465-129175487 CCAAAAATGAAAAATTAGCCAGG - Intergenic
1000525440 5:162352153-162352175 CCAGATATGAAATTCTTGGCTGG + Intergenic
1003927710 6:10892458-10892480 CAAAAAATGAAAAACTAGCCAGG - Intronic
1005936724 6:30528603-30528625 AAAAATATGAAAAACTAGCCTGG + Intergenic
1006784858 6:36659482-36659504 CCAAATATTTAACAATTGCCTGG + Intergenic
1008407437 6:51135018-51135040 CCAAATTGGAAACACTTCTCTGG - Intergenic
1010673742 6:78717690-78717712 CCAAATATAAAACAAATTCCAGG + Intergenic
1010791472 6:80070068-80070090 CCAAAGATGAAACATTCTCCTGG - Intergenic
1012191791 6:96288315-96288337 CCAAAGATGAAGCACTCTCCAGG + Intergenic
1013551969 6:111216825-111216847 CCCAATATGAAACAGTTTTCAGG + Intronic
1014233718 6:118933195-118933217 CCAAATAAGAAACACTTATTTGG + Intronic
1015598163 6:134886297-134886319 CCAAATATTAAATACTTTCCAGG - Intergenic
1017423427 6:154296437-154296459 CCAAAAATGAATCTCTAGCCTGG - Intronic
1019049197 6:169170239-169170261 CCAAATTAGAAAGACCTGCCTGG - Intergenic
1019893734 7:3966844-3966866 CCAAAAATGAAAAATTAGCCAGG - Intronic
1021479488 7:21100399-21100421 AGAAATTTGAAACACTTGCAAGG + Intergenic
1022051732 7:26681152-26681174 ACAAAATTAAAACACTTGCCGGG + Intronic
1023572140 7:41583175-41583197 CCAAAAATGAAGCACATGGCTGG - Intergenic
1025982695 7:66419928-66419950 CAAAAAATAAAACACTAGCCGGG - Intronic
1028524905 7:91773345-91773367 CCAAATAGAAAACCCTGGCCAGG + Intronic
1031580931 7:123473879-123473901 TCAAATATTAAAAACTTGGCTGG - Intronic
1031839527 7:126720496-126720518 TCACATATGAAACCCTTGTCAGG - Intronic
1034081791 7:148285554-148285576 CCAAGTGTGAAACACCTGCCTGG + Intronic
1036967962 8:13321242-13321264 TCAAAAATGAAATACTGGCCCGG + Intronic
1037266443 8:17066840-17066862 CAAAATATGAAACTGTGGCCAGG - Intronic
1038489073 8:27956802-27956824 CCAAACAACAAACACTTACCAGG - Intronic
1039262608 8:35788339-35788361 CAAAATAGGAAATACTTGGCTGG + Intronic
1039638442 8:39192786-39192808 CCAAATATGAAATTCTTGGTTGG + Intronic
1039680762 8:39733292-39733314 ACAAATGTGAACCACATGCCTGG - Intergenic
1039951221 8:42174235-42174257 ACAAATATGAAAAATTAGCCGGG + Intergenic
1041248538 8:55912427-55912449 CCAAATAAGAAATTCTTGGCTGG + Intronic
1043240140 8:77922938-77922960 TAAAATATGAAACACTGGACTGG + Intergenic
1043263527 8:78232056-78232078 CTGAATATGAAACATTTGCTGGG - Intergenic
1047704694 8:127486107-127486129 CAAGGTATGTAACACTTGCCTGG + Intergenic
1048203187 8:132394056-132394078 CCAAATACCAACCACGTGCCAGG + Intronic
1048912932 8:139153476-139153498 CCAGAACTGAAACACTTGGCAGG + Intergenic
1050230269 9:3516828-3516850 CCAAATGTCAGACACTTGTCTGG + Intronic
1050268535 9:3917131-3917153 CCAAATTGGAAATACTAGCCAGG + Intronic
1050564433 9:6867307-6867329 ACAAATATGCAGCACTGGCCGGG - Intronic
1051949281 9:22611556-22611578 CCAAATATGAGACAGTAGCAAGG - Intergenic
1051990588 9:23147266-23147288 CCAAATATCAGACAATAGCCTGG - Intergenic
1053531017 9:38880901-38880923 CCAAATATGAAATTCTTGGTTGG - Intergenic
1054203241 9:62105333-62105355 CCAAATATGAAATTCTTGGTTGG - Intergenic
1054635121 9:67483031-67483053 CCAAATATGAAATTCTTGGTTGG + Intergenic
1055649413 9:78392614-78392636 CAAAATATGATACCCTGGCCTGG - Intergenic
1057396472 9:94684804-94684826 CTAAAGATGAAACACTTGGCTGG - Intergenic
1059156425 9:111992763-111992785 AAAAATATGAAACTTTTGCCAGG + Intergenic
1060476160 9:123988356-123988378 CCAAAAATTTAACACTGGCCAGG - Intergenic
1061888277 9:133604175-133604197 CCAACTATGAAATCCTTCCCTGG + Intergenic
1185453021 X:292906-292928 CCAAAAATGAAATTCTGGCCGGG - Intronic
1186032342 X:5381940-5381962 ATAAATATGAAACACAAGCCAGG + Intergenic
1186101194 X:6158325-6158347 CCAAATATGAAACAAAAGCATGG - Intronic
1189266574 X:39721255-39721277 CCTAATATGATACTCTTTCCTGG - Intergenic
1193963480 X:87953835-87953857 CAAAATATGAAATTCTTGGCTGG - Intergenic
1197916452 X:131541048-131541070 ACAAATAGCAAACACTTTCCTGG + Intergenic
1200987790 Y:9322829-9322851 CCACAAATGAAAAGCTTGCCAGG + Intergenic
1201331141 Y:12822659-12822681 CAAAATTTAAAACTCTTGCCTGG - Intronic
1201970320 Y:19786102-19786124 ACAGATATGACACACATGCCTGG - Intergenic