ID: 916295474

View in Genome Browser
Species Human (GRCh38)
Location 1:163214428-163214450
Sequence ATGTAGTAATAGAAATGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 350}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916295474_916295476 5 Left 916295474 1:163214428-163214450 CCTTCACATTTCTATTACTACAT 0: 1
1: 0
2: 2
3: 20
4: 350
Right 916295476 1:163214456-163214478 TACCCTTGCTCACAGATACAGGG 0: 1
1: 0
2: 0
3: 6
4: 115
916295474_916295475 4 Left 916295474 1:163214428-163214450 CCTTCACATTTCTATTACTACAT 0: 1
1: 0
2: 2
3: 20
4: 350
Right 916295475 1:163214455-163214477 ATACCCTTGCTCACAGATACAGG 0: 1
1: 0
2: 0
3: 7
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916295474 Original CRISPR ATGTAGTAATAGAAATGTGA AGG (reversed) Intronic
901227039 1:7619496-7619518 ATGAGGTAAGAGAAGTGTGAAGG - Intronic
903107534 1:21095968-21095990 TTGTAGAACTAAAAATGTGAGGG - Intronic
905075914 1:35269886-35269908 AGGAAGTAAAAGAAAAGTGAGGG - Intronic
905084996 1:35365562-35365584 ATGTAGTAATTCAAATGTTGGGG + Intronic
905348228 1:37326307-37326329 AGGTAGGAATAGAAATGGGATGG - Intergenic
905501676 1:38444612-38444634 AAGTAGTAATAGAAAGCTGTGGG - Intergenic
906911381 1:49955053-49955075 ATGTAATAATAAAATTTTGAAGG - Intronic
907099214 1:51812793-51812815 ATGTAGAAATCAAAATGTGTTGG + Intronic
907160833 1:52367580-52367602 ATACAGTAAGATAAATGTGAAGG + Intergenic
907169644 1:52450774-52450796 ATGAAGTAATAGAAATACCAAGG - Intronic
907506897 1:54925720-54925742 AGGTAGGCATAAAAATGTGATGG - Intergenic
909345471 1:74580607-74580629 ATTTAGTAATTGAAAAGTGGTGG + Intronic
909368451 1:74857051-74857073 ATGGAAGAACAGAAATGTGATGG - Intergenic
910134033 1:83945003-83945025 ATATAGTAAAAGAAATGACAAGG + Intronic
910672042 1:89783417-89783439 ATATAGTTAGATAAATGTGAAGG + Intronic
910949813 1:92634104-92634126 ATGAAGTTTTAGAAATGTTAAGG - Intronic
911326807 1:96478086-96478108 ATGTAGTCAGAGTATTGTGATGG + Intergenic
911418826 1:97612996-97613018 GGGTAGTAATAAAAATGTGATGG - Intronic
911562575 1:99424452-99424474 ATGTTTTAGTAGAAATGTCATGG - Intergenic
913179232 1:116303674-116303696 CTGTGGTGATAGAAATGTTATGG - Intergenic
913647688 1:120875595-120875617 AGGTAGAAAAAGAAATGTAATGG + Intergenic
915144227 1:153785327-153785349 ATATAGTTAGATAAATGTGAAGG - Intergenic
916295474 1:163214428-163214450 ATGTAGTAATAGAAATGTGAAGG - Intronic
920166215 1:204037876-204037898 ATAAAGAAATAGAAATGTGTGGG + Intergenic
923431802 1:233929540-233929562 ATGTACTAAAAGAAATGAAAAGG - Intronic
923501007 1:234564344-234564366 ATGAATGAATAGAAATGTCAGGG - Intergenic
923587422 1:235286567-235286589 ATCTAGTAAAAGAATTCTGATGG + Intronic
924686746 1:246300370-246300392 ATGTATTAAAGGTAATGTGATGG + Intronic
1063650498 10:7931920-7931942 ATGAAATAATAGAAATGTACTGG + Intronic
1063700770 10:8383175-8383197 ATGTTCTAAGAGAAAAGTGAAGG - Intergenic
1064132332 10:12721211-12721233 ATCGAGTAATTGAAATGTGTGGG - Intronic
1064496372 10:15914871-15914893 ATGTAGTAAAACAAAGGTGGAGG - Intergenic
1065069793 10:22011460-22011482 ATGTACTAAAAGCAATGTAAAGG - Intergenic
1065178657 10:23103499-23103521 ATGTAGTAATATAGATGCCAAGG + Intronic
1068930472 10:62583993-62584015 AAGTAGTAATAATAATTTGAAGG - Intronic
1069181502 10:65365788-65365810 ATTTTTTAATAGAAATATGAAGG + Intergenic
1072597943 10:96893056-96893078 ATGTAGTAAAATAAATGAGAAGG - Intronic
1073592335 10:104769154-104769176 ATGTAGTGTGAGAAATGTGTGGG + Intronic
1073624532 10:105083406-105083428 ATTTGGTCCTAGAAATGTGAAGG + Intronic
1073996433 10:109320757-109320779 ATGTAATAATTGACATGTTAAGG + Intergenic
1074523013 10:114241723-114241745 ATGTAATTATAGCAATGAGAGGG + Intronic
1074766351 10:116702707-116702729 ATGAAGGAATAAAAATTTGAAGG - Intronic
1075194169 10:120340587-120340609 ATGCAGTAATAGATATCTAATGG - Intergenic
1077733948 11:4768325-4768347 AGGTAGGAATAGATATGTCATGG - Intronic
1078927346 11:15886700-15886722 ATGGAGTGACAGGAATGTGATGG - Intergenic
1079441880 11:20523234-20523256 AAGTAGTAATAGGAAGGTTAGGG + Intergenic
1079840443 11:25391626-25391648 ATATAGAAATATAAATATGAGGG - Intergenic
1080613481 11:33925679-33925701 ATAGAGTAAAAGAGATGTGAAGG + Intergenic
1080784852 11:35465715-35465737 ATGTAGTTATAGTGAAGTGAAGG - Intronic
1082187110 11:49196887-49196909 GTGCAGTAATACAAATGGGAGGG + Intronic
1085705570 11:78784302-78784324 TTGTTGAAATAGAAATGAGAAGG - Intronic
1086420553 11:86633529-86633551 ATGTAATAAGAGAAATGAAAAGG + Intronic
1086474777 11:87160771-87160793 ATGAGGTAATAGATTTGTGAAGG - Intronic
1086511594 11:87564095-87564117 ATGTTTTAATAGAAAAGTAATGG - Intergenic
1087147406 11:94825741-94825763 ATGGAGTAATAGAAAGAAGAAGG + Intronic
1087191685 11:95261012-95261034 AAGAAGTAAAAGAAATGTAAAGG + Intergenic
1090069241 11:123529277-123529299 TTGGAGTAATTGAAATGTGAGGG + Intronic
1091198970 11:133756804-133756826 GTTGAGTAATAGAAATATGATGG - Intergenic
1091535366 12:1402839-1402861 CTTTAGTAATAGAAGTCTGAAGG - Intronic
1091609476 12:1992656-1992678 ATGTAGTATGAGAAAGGCGATGG + Intronic
1093260041 12:16924705-16924727 ATGTAGTTATACAAAAGTAATGG - Intergenic
1093897504 12:24591269-24591291 ATGTGGTAATAGACTTGTAATGG - Intergenic
1094238766 12:28199211-28199233 ATTTAGTAAAAGAAACGTCAAGG - Intronic
1094307660 12:29038759-29038781 ATGGATTAAAAGAAATGTGCAGG - Intergenic
1094764878 12:33582093-33582115 ATATAGTAATTAAAATCTGAAGG + Intergenic
1095779866 12:46047860-46047882 ATGTAGTAAAAGAAACAGGAGGG + Intergenic
1096695713 12:53346876-53346898 GTGTTGTACTGGAAATGTGATGG - Intergenic
1097615223 12:61876932-61876954 ATGTAGTTATAAAAGTGTGTGGG - Intronic
1098380517 12:69864792-69864814 ATGTAGTGAGAGGAATGTGAGGG - Intronic
1098463569 12:70760841-70760863 ATGGAGTAATAGAATTGGAAAGG + Intronic
1099635802 12:85209434-85209456 ATATGGTAGTAGAAATCTGATGG - Intronic
1100142769 12:91638665-91638687 GTCTGGTAATAGTAATGTGATGG - Intergenic
1100564428 12:95781655-95781677 ATGGAGAAATAGAAATGACATGG - Intronic
1102079473 12:110086347-110086369 ATCTAGTAATAGAGGTGTGGAGG + Intergenic
1102710626 12:114923209-114923231 AAATAGTAAGATAAATGTGAGGG + Intergenic
1102836861 12:116071831-116071853 ATGTTGTAATAGTAGTTTGAAGG - Intronic
1104099765 12:125596078-125596100 TTGTACTAACAGAGATGTGATGG + Intronic
1105489122 13:20870448-20870470 ATTTACTAATAAAACTGTGAGGG + Intronic
1105655021 13:22427262-22427284 ATGTGGTCATAGAAATGTTTCGG - Intergenic
1106374613 13:29173457-29173479 ATGCATAAATTGAAATGTGAAGG - Intronic
1107292860 13:38876770-38876792 ATGTATTATAAAAAATGTGATGG + Intronic
1107328243 13:39268777-39268799 GTGTATTAATAGAAATGTGGAGG + Intergenic
1107631271 13:42344832-42344854 GTGTGGAAATAGAAATGGGAAGG + Intergenic
1107805042 13:44145775-44145797 ATGTATTACTTGAAATGTTATGG + Intronic
1107939945 13:45374553-45374575 ACGTAGTAATAAAAATGTGTAGG - Intergenic
1108087999 13:46816245-46816267 ATGTAGTAATACATAATTGACGG + Intergenic
1108325803 13:49329922-49329944 ATGCAGTTAGATAAATGTGAAGG - Intronic
1109198978 13:59410136-59410158 AAGAAGTAAAAGAAAAGTGATGG - Intergenic
1109712166 13:66176167-66176189 ATTGAGTAATAGATATATGATGG - Intergenic
1109965497 13:69688078-69688100 ATGTAGTAAAAGAAAAGCTAAGG - Intergenic
1110035363 13:70675814-70675836 ATGTATTAAAAGACATGTAAGGG + Intergenic
1110137958 13:72091467-72091489 ATGAAGTAGTGGAAATGTGAAGG - Intergenic
1110958001 13:81581050-81581072 CTGTAGTAATTGAAAGGTGAAGG + Intergenic
1110975590 13:81830050-81830072 ATGTAGATATAGATATATGATGG + Intergenic
1112218926 13:97467887-97467909 ATGTTTTAATTGAAATGTCAAGG - Exonic
1112549078 13:100403169-100403191 CAGTAGTAAAAGAAATGGGAAGG + Intronic
1113930922 13:113968430-113968452 CTTTAGTAATAGAAGTGAGAAGG - Intergenic
1114177112 14:20332245-20332267 ATGTAGTAATAGGTATTTGTAGG - Intronic
1115867582 14:37764970-37764992 ATACAGTAAAAGAAATGAGAAGG - Intronic
1116145632 14:41064552-41064574 ATGAAGTAAATGAAATGTAATGG - Intergenic
1116207220 14:41883711-41883733 ATGTAGGCATAGAAATAAGACGG - Intronic
1116400018 14:44495275-44495297 TTGTGCTAATAGAAGTGTGAGGG - Intergenic
1117255029 14:53968944-53968966 CTGTAGCAAAAGACATGTGAAGG + Intergenic
1117391870 14:55270658-55270680 GTGTAGTAAAATATATGTGATGG + Intergenic
1117437509 14:55730892-55730914 AGATAGTAAGAGATATGTGAAGG + Intergenic
1117682531 14:58219608-58219630 ATTGAAAAATAGAAATGTGAAGG + Intronic
1117903511 14:60560502-60560524 ATGCAGTAATAGAGATGAGAAGG - Intergenic
1120527885 14:85598894-85598916 ATGAAATAAGAGAAATGGGATGG + Intronic
1121263163 14:92581257-92581279 ATCTACTAATAGATAGGTGATGG - Intronic
1121382254 14:93482955-93482977 ATGTAGTAATTGAAACAGGAAGG - Intronic
1121704732 14:95983002-95983024 AGGCAGGAATAGAAATGAGAAGG - Intergenic
1124147940 15:27146792-27146814 ATGTAGTAAAAGAAAGGACAAGG + Intronic
1125928387 15:43582336-43582358 ATATAGTCATAAAAATTTGAGGG - Intronic
1125941553 15:43682171-43682193 ATATAGTCATAAAAATTTGAGGG - Intergenic
1126122036 15:45261955-45261977 TTGAATTAATAGAAATGGGATGG + Intronic
1126522309 15:49609203-49609225 AACTAGAAATAGAATTGTGATGG + Intronic
1127270982 15:57401888-57401910 CTCTAGTAAGTGAAATGTGAAGG + Intronic
1127585955 15:60378147-60378169 ATCAAGAAATAGAAATGGGATGG - Intronic
1128188406 15:65665406-65665428 ATGTTTTAATACAAATGTTATGG - Exonic
1129016291 15:72472221-72472243 ATGTAGTAATAGAATACAGATGG + Intergenic
1131203920 15:90425435-90425457 ATGTACTAAGAGATATTTGAAGG + Intronic
1132612256 16:823001-823023 ATGTAGACACAGAAAAGTGATGG + Intergenic
1134599137 16:15519748-15519770 ATGAAATAATCTAAATGTGAGGG - Intronic
1136091333 16:27922385-27922407 ATTTGGTTATAGATATGTGAAGG - Intronic
1138124554 16:54428030-54428052 ATGTATTATAAGAGATGTGAAGG - Intergenic
1138762910 16:59565317-59565339 ATCTATAATTAGAAATGTGAGGG - Intergenic
1139388914 16:66592971-66592993 ATGAAGTTATAGAAATGTTTTGG - Intergenic
1140832317 16:78763337-78763359 ATGCTGTAATAAACATGTGAGGG - Intronic
1141154965 16:81590867-81590889 AAGAGGAAATAGAAATGTGATGG - Intronic
1142436589 16:90062871-90062893 ATGTACTAGTTGACATGTGATGG + Intronic
1142936303 17:3335565-3335587 ATTTAGGAATAGAAAATTGATGG - Intergenic
1145400890 17:22531518-22531540 TTGTGGTAATCAAAATGTGATGG - Intergenic
1146662108 17:34671711-34671733 ATGCAGTCATAGAAAAGAGAAGG + Intergenic
1149187065 17:54010914-54010936 ATGCAAAAGTAGAAATGTGAAGG + Intergenic
1149188078 17:54025628-54025650 ATGTAGAATAAGAAATGTTATGG + Intergenic
1152414449 17:80150141-80150163 ATCTAGTCATAAAAATATGAAGG - Intergenic
1153217958 18:2837549-2837571 ATTTAGAAATAGATTTGTGAGGG - Intergenic
1156794950 18:41033084-41033106 ATGTATTAACAGAAGAGTGACGG - Intergenic
1156828347 18:41461093-41461115 CTGTACTAATAGTAATGTAAAGG - Intergenic
1157199529 18:45647362-45647384 ATGTAAGAGTAGAAATGAGAAGG - Intronic
1158433419 18:57414310-57414332 ATGAGGGAATAGATATGTGAGGG + Intergenic
1158997882 18:62941964-62941986 GTGTATTCATAGAAAGGTGAAGG + Intronic
1159262869 18:66038467-66038489 ATGCAGAAATAGAACTGTCAAGG + Intergenic
1159397509 18:67881695-67881717 AGGTATTAATATAAATGTAAAGG - Intergenic
1163880525 19:19917094-19917116 ATGTAGTAATAAAAATAGAATGG - Intronic
1163984759 19:20935488-20935510 ATGTAGTAATACAAACAGGATGG - Intronic
1165648402 19:37465159-37465181 AGGTAGTAATAAAGATATGAAGG - Intronic
1168589089 19:57617899-57617921 CTGTAGTAATAGAAGTGAGGTGG + Intronic
925545417 2:5010539-5010561 ATGTGGGAATAGAAATGACATGG + Intergenic
926003193 2:9350958-9350980 ATGCAGTGTTTGAAATGTGAAGG - Intronic
927829801 2:26339673-26339695 ATGCAGTTAGATAAATGTGAAGG - Intronic
928421863 2:31143380-31143402 AAGAAGGAATAGAACTGTGATGG + Intronic
928751488 2:34475554-34475576 TTTTAGCAATAGAATTGTGAAGG + Intergenic
929757057 2:44775785-44775807 ATGTATTAATTGAAAAGTCAGGG - Intergenic
930125919 2:47796348-47796370 ATGGAGTAATATATATATGAGGG + Intronic
931648269 2:64445146-64445168 ATATATTAATAGAAATGAGAAGG - Intergenic
931745312 2:65286873-65286895 ATGTAGTCATAGAAACTTTAAGG - Intergenic
932184285 2:69678695-69678717 AAGTAGAAATAGAAATTTGTGGG - Intronic
933058930 2:77710710-77710732 ATGTAGTAATTGAAAGGTTATGG - Intergenic
935902497 2:107807527-107807549 ATGTAGTAATGGCAATATTAAGG - Intergenic
937699707 2:124850568-124850590 CTGTAATAATAGAAATTTGGAGG - Intronic
938172862 2:129096985-129097007 ATATAGTAAAAGAAATGAAAAGG - Intergenic
938641710 2:133287933-133287955 AAGTTGTAATAGAAATGTTATGG - Intronic
939456736 2:142446660-142446682 ATTTGGGAATAGTAATGTGATGG - Intergenic
939549851 2:143601557-143601579 ATTTACTAAGAGAAAGGTGATGG - Intronic
939833204 2:147097214-147097236 ATGTGGTAATGGGAAAGTGAGGG - Intergenic
940543720 2:155055831-155055853 ATTTAGTGATGGAAAGGTGAAGG + Intergenic
941315320 2:163984816-163984838 TTGTAGAAAAAAAAATGTGATGG - Intergenic
942027758 2:171927458-171927480 ATGAAGTAATTGAAAAATGAGGG - Intronic
942875584 2:180792660-180792682 ATGTATTAATACACATGAGAAGG + Intergenic
943150859 2:184110664-184110686 ATGTAGAATTAGCAAAGTGATGG - Intergenic
943829194 2:192437275-192437297 ATGTATTAATAGATATATTAGGG - Intergenic
944385785 2:199163189-199163211 ATGGATTAAGAGAAATGAGAAGG - Intergenic
945060565 2:205905133-205905155 CTGTAGTAATAGAAAGCAGATGG - Intergenic
947411438 2:229844948-229844970 GTGTAATAGTAGAAATGTGTTGG - Intronic
947671150 2:231936375-231936397 ATGTAGTCAAAGAAAAGTGCAGG - Intergenic
948579654 2:238976636-238976658 ATATAGTAAAAGAAATGACAAGG + Intergenic
1169665879 20:8035072-8035094 TTGTAGCAAAAGCAATGTGAAGG - Intergenic
1171056202 20:21909305-21909327 AGGTAGAAATAGACATATGATGG + Intergenic
1171158886 20:22903579-22903601 ATAAACTAAAAGAAATGTGAGGG + Intergenic
1171402292 20:24882397-24882419 ATGTAGTAATTAAAAACTGATGG + Intergenic
1171940971 20:31329567-31329589 ATGTAGAAAAGGGAATGTGAAGG - Intergenic
1173385691 20:42585776-42585798 ATGTAATAATAGAAATCTATTGG + Intronic
1174984631 20:55436853-55436875 ATGTATTCTGAGAAATGTGAGGG + Intergenic
1175360708 20:58409968-58409990 ATTTAATATTAGAAATGTTAAGG + Intronic
1176911797 21:14574505-14574527 ATCTAGTTATAGAATTGTTATGG - Intronic
1177684967 21:24424070-24424092 ATGTAGTAATGCTAATGTGGAGG + Intergenic
1177739336 21:25135562-25135584 AGGTTGTAAAAGAAAGGTGAGGG + Intergenic
1177914700 21:27074476-27074498 TTCTATTAATAGAAGTGTGATGG - Intergenic
1178562228 21:33649318-33649340 ATGTATTAATAAAAATGTTTTGG - Intronic
1181337213 22:22146530-22146552 AGGTAATAATAGGAATGTTATGG - Intergenic
1183753523 22:39737022-39737044 ATATAAGAACAGAAATGTGAAGG + Intergenic
1203294071 22_KI270736v1_random:23852-23874 ATTTAGAAATAGAAATATTAAGG - Intergenic
949640257 3:6028723-6028745 ATGAAGAAAAAAAAATGTGAAGG - Intergenic
950981819 3:17315325-17315347 AAGTAGGGATACAAATGTGAGGG + Intronic
951807296 3:26660095-26660117 ATGGAGTAATATAATTATGAAGG - Intronic
953072343 3:39533712-39533734 AAGTAGTAAGATAGATGTGATGG + Intergenic
953149616 3:40312922-40312944 ATGTAGTAAAAGAAATTTCCTGG - Intergenic
954904278 3:54046568-54046590 ATGGAATAGTAGAAATGTGGCGG - Intergenic
955127718 3:56130709-56130731 ATGGAGAAATTGAAATGTGATGG - Intronic
956059990 3:65339695-65339717 ATGTAGTGATAACTATGTGATGG + Intergenic
956072157 3:65464762-65464784 ATGTAGTTATTGATATGTTAGGG + Intronic
956335594 3:68159835-68159857 ATATAGTGATAGAAATGAGCAGG - Intronic
957559609 3:81805538-81805560 ATGAAGAAATAGTAATGTGGAGG - Intergenic
957855146 3:85865393-85865415 ATATAATAATAAAAATATGAAGG - Intronic
957945305 3:87056351-87056373 ATGGAATAATAGAAAAGAGAAGG - Intergenic
958263943 3:91415130-91415152 ATTTAGGACTAGAAATCTGATGG - Intergenic
958830947 3:99088541-99088563 ATGAATTAATAAATATGTGATGG - Intergenic
960735509 3:120775172-120775194 ATGAAGTAAGACAAAAGTGAAGG + Intronic
960848305 3:122024838-122024860 ATATATTAATAGCTATGTGAGGG - Intergenic
962039223 3:131687465-131687487 AATTCGTAATAAAAATGTGATGG - Intronic
962639394 3:137369120-137369142 ATGTAGTTATAGATAAGTTAAGG + Intergenic
963489432 3:145980911-145980933 AAGTGGTAATAGAAATATGTTGG - Intergenic
963950209 3:151191003-151191025 ATGTAGTGGTAGAAGAGTGATGG + Intronic
964171385 3:153774359-153774381 ATGAAGTAATATAAAAGGGATGG + Intergenic
965043947 3:163551167-163551189 ATGTAGAAAGAGAAAAATGAAGG - Intergenic
965301827 3:167014490-167014512 ATGTAGAATGAGAAATGGGAAGG - Intergenic
966234990 3:177690842-177690864 ATATAGTATTAGCAATGTAATGG + Intergenic
966507443 3:180722419-180722441 AACTAGCAATAGAAATGTTAAGG - Intronic
967699111 3:192570940-192570962 ACGTAGTAATGGAAAAGGGAGGG + Intronic
970294688 4:14615985-14616007 ATGAAGAAATAGAATCGTGATGG - Intergenic
970507048 4:16742368-16742390 ATGTTGTATAAGAAATGTGTTGG - Intronic
970769200 4:19590321-19590343 GTGGAGTAATAAAAATGCGATGG + Intergenic
971071126 4:23093104-23093126 ATGTATTAATAGATATGGTACGG - Intergenic
971138108 4:23892368-23892390 GTCCAGTAATAGAAATTTGAGGG - Intronic
971280056 4:25235162-25235184 ATGGAGTTAGACAAATGTGATGG + Intronic
971828526 4:31659800-31659822 ATGAAGGAATAGAAATGGAATGG + Intergenic
972033905 4:34496690-34496712 TTATACTAATAGAAAAGTGAAGG + Intergenic
973134368 4:46688325-46688347 ATGTGGTAATAGAATTTTAAAGG + Intergenic
974502201 4:62720985-62721007 ATGTACTATTAGTAATGTAATGG - Intergenic
974725328 4:65791717-65791739 ATGTAGATAGAGAATTGTGATGG + Intergenic
975207856 4:71664897-71664919 ATGAAGTAAAAAAAATGTCATGG + Intergenic
975434850 4:74340094-74340116 ATGTTTTAATATAAATGTGCTGG - Intergenic
975438026 4:74376363-74376385 ATGTAGGAATAGGAATGTCAAGG + Intronic
975693934 4:76993111-76993133 TAGTAGGAATAGAAATGTGGAGG + Intronic
975743068 4:77449460-77449482 ATATAGTAATAAACATGAGAAGG - Intergenic
976534997 4:86202608-86202630 TTGCAGTAGTAGAAATATGAAGG + Intronic
977362630 4:96025546-96025568 ATTTAGAAAAAGAAATGGGAAGG - Intergenic
978491244 4:109314269-109314291 ATGGAGTAATACTAAGGTGAAGG - Intergenic
978568808 4:110113810-110113832 ATGTAGAAATAGAATTCAGAAGG + Intronic
979367725 4:119845629-119845651 ATGTTATAACAGAAATGTAATGG - Intergenic
979563290 4:122124224-122124246 ATGTACTAATGGAAATGTTAGGG - Intergenic
979843946 4:125484403-125484425 CTGTAATAATAGTAATGTGATGG + Intronic
979960398 4:127013232-127013254 ATGTAGTTCTAGAAATGAGGCGG + Intergenic
980245379 4:130232742-130232764 ATGTAGGAAGAGACATGTAAAGG + Intergenic
981328430 4:143479043-143479065 ATGTACAAACAAAAATGTGAAGG - Intergenic
981543894 4:145874428-145874450 ACGTAAAAATAGAAATATGAAGG + Intronic
981598822 4:146460993-146461015 AAGTAGTAACAGAAATTTGGTGG - Intronic
982104735 4:152001729-152001751 ATGTAATAGTAAAAATCTGAAGG - Intergenic
982239764 4:153287565-153287587 GTATAGTAAAAGAAATGAGAAGG - Intronic
983903587 4:173162504-173162526 ATGTATAAATTGAAATCTGAAGG + Intergenic
984607545 4:181803083-181803105 TTTTAGTAATAGAAATGTGATGG - Intergenic
986120478 5:4831139-4831161 ATGTTTTAATAAAAATATGAAGG - Intergenic
986308709 5:6534976-6534998 ATGTAGTAATAGAAACAATATGG - Intergenic
987996342 5:25285751-25285773 ATGTAGTTATTGAGATTTGAAGG - Intergenic
988969864 5:36456617-36456639 GTGTAGTGATAGAAAAATGACGG + Intergenic
989669471 5:43898223-43898245 ATGTAGAAAGTGAAATGGGATGG + Intergenic
989802169 5:45556296-45556318 ATGTATTAATAAACAGGTGAAGG - Intronic
990262286 5:54036416-54036438 ATGTAGAAGTAGAAATTGGATGG - Intronic
991077551 5:62557563-62557585 AATCAGTAATAGAAATGTAAGGG + Intronic
991126722 5:63077997-63078019 ATGTTGACAAAGAAATGTGAGGG - Intergenic
991578671 5:68131540-68131562 ATTAAATAATAGACATGTGAAGG + Intergenic
991608413 5:68426128-68426150 ATGTAGTCAATGAAATCTGACGG - Intergenic
992178523 5:74174193-74174215 AGGCAGTAATAGAACTGGGAGGG + Intergenic
993701501 5:91124215-91124237 TTGTGGTACTAGTAATGTGATGG - Intronic
993777536 5:92018966-92018988 CTGTAGTAACATATATGTGAGGG - Intergenic
993809051 5:92452812-92452834 ATGAAATAACAGAACTGTGAAGG - Intergenic
993818764 5:92587408-92587430 ATGTAGAGATAGAAATGTGTTGG + Intergenic
994514074 5:100748035-100748057 TTGTAGTAATAGAAATTTTGGGG - Intergenic
994529565 5:100952064-100952086 ATGTTGTAATAGAGATTTTATGG + Intergenic
994562151 5:101388718-101388740 AGGTAGTAAGAGAAATGAGTAGG + Intergenic
995018206 5:107337075-107337097 ATGAAGAAATAAAAGTGTGAAGG - Intergenic
995886293 5:116898110-116898132 ATGTAGCAATAGAAATTTGAAGG + Intergenic
996152219 5:120053161-120053183 ATGTATTTATGAAAATGTGAAGG - Intergenic
997015264 5:129925350-129925372 GTTTAGTAAGAGAAATGGGAAGG + Intronic
997404837 5:133637318-133637340 ATGTATTAATAGCAATGGGGAGG - Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998277513 5:140770823-140770845 CTGTAGTAATGGAAATGTTCTGG - Intergenic
998775709 5:145599199-145599221 GTGTGGTAATAGAACTGTCATGG - Intronic
1000874679 5:166621183-166621205 ATATAGTAATACAAAAGAGAGGG - Intergenic
1004229520 6:13818461-13818483 AGGTAGTAACAGAAAGGTCAAGG + Intergenic
1005947835 6:30607730-30607752 AGGTAGAAAGAGAAAAGTGAAGG + Intronic
1006205662 6:32339930-32339952 AAGTTGTATTAGAAATGTTATGG + Intronic
1006640977 6:35489706-35489728 TTCTTGGAATAGAAATGTGAGGG + Intronic
1008012056 6:46478549-46478571 ATGTGGACATAGACATGTGATGG - Intronic
1008742336 6:54624716-54624738 ATTTATAAAAAGAAATGTGACGG + Intergenic
1008991491 6:57607844-57607866 ATTTAGGACTAGAAATCTGATGG + Intronic
1010801221 6:80177882-80177904 ATTTAGTAATATAAATGATATGG - Intronic
1010897825 6:81387267-81387289 AGGCAGAACTAGAAATGTGAGGG + Intergenic
1010910613 6:81550668-81550690 ATTTATTATTAGAAATTTGAGGG - Intronic
1011495435 6:87932707-87932729 AAGTGGTAACAGAAATGTTAAGG - Intergenic
1011925116 6:92633009-92633031 ATGGAGAAAGAGAAATGTGTTGG - Intergenic
1012030129 6:94049283-94049305 ATGGTGTTTTAGAAATGTGAAGG + Intergenic
1012779611 6:103540897-103540919 GTGTACTAAAAGAAATGTGTTGG - Intergenic
1015153724 6:130066752-130066774 ATTTAATAATAGAAATTTGCAGG - Intronic
1015228971 6:130891746-130891768 ATGTAGTAATAAAACTGATATGG - Intronic
1016196688 6:141352396-141352418 ATGCAGTGATAAAAATATGATGG + Intergenic
1017951045 6:159135499-159135521 ATGAAGTAATTCAAATGTGGAGG + Intergenic
1018279944 6:162174480-162174502 ATATAGAAATAGAAATATGCAGG - Intronic
1018322513 6:162626864-162626886 ATGCAGTTAAAGACATGTGAAGG - Intronic
1019857473 7:3623885-3623907 ATATAAAAATAGAAATTTGATGG + Intronic
1020799163 7:12712225-12712247 ATTTAGTGATAGAAATATTAAGG + Intergenic
1022094816 7:27131964-27131986 ATTTGGTAATTGAAATTTGATGG + Intronic
1022257934 7:28677969-28677991 CTTTATTAATAGAAATGGGAAGG - Intronic
1023114774 7:36851868-36851890 TAGTAGTAATAGAAATGGGGAGG - Intergenic
1024622518 7:51174447-51174469 ATATAGTAAAATAAATGAGAAGG + Intronic
1024710782 7:52012238-52012260 ATGTAGTAAGAGTCATATGAGGG - Intergenic
1024930987 7:54666599-54666621 CTGTAGTAACAAAAATCTGATGG - Intergenic
1025219898 7:57098367-57098389 ATGTTGGGACAGAAATGTGAAGG - Intergenic
1025630680 7:63269915-63269937 ATGTTGGGACAGAAATGTGAAGG - Intergenic
1025651792 7:63476693-63476715 ATGTTGGGACAGAAATGTGAAGG + Intergenic
1026495489 7:70898159-70898181 TTGCAGTGATGGAAATGTGATGG - Intergenic
1029908471 7:104118516-104118538 ATCTTGTAAAAGAAGTGTGAGGG - Intergenic
1030332256 7:108283790-108283812 ATGGAGTAAGAGAATTGTAAGGG - Intronic
1030698909 7:112617303-112617325 ATGAAGGAATATAAAAGTGATGG + Intergenic
1030752939 7:113253681-113253703 ATGTAGTAAAAGTAAAGTAAAGG + Intergenic
1032727420 7:134603741-134603763 ATGCAGTTAGATAAATGTGAAGG + Intergenic
1033793868 7:144824098-144824120 ATGTGGTAAGAGACATGTAAGGG - Intronic
1036326913 8:7786914-7786936 ATGTAATCAGGGAAATGTGATGG + Intergenic
1036666795 8:10750437-10750459 AAGCAGTAATGGAAACGTGAGGG - Intronic
1038962133 8:32532701-32532723 ATGTATTAATAGAGATTTCATGG + Intronic
1039213478 8:35241459-35241481 ATTCAGTGATAGAAATATGAGGG + Intronic
1039357416 8:36835954-36835976 AGGTAAAAATAGAAATTTGATGG - Intronic
1039664925 8:39515195-39515217 ATATAGTAACAGAAATTAGATGG - Intergenic
1040918619 8:52590732-52590754 ATATAGTTATAGCTATGTGAAGG + Intergenic
1042752979 8:72178635-72178657 ATGGAGTAATACACATCTGAAGG - Intergenic
1043555129 8:81421475-81421497 ATGGAGTGAGAGGAATGTGAGGG + Intergenic
1043771222 8:84203591-84203613 ATATATTACTAGAAAAGTGAGGG - Intronic
1043880484 8:85536822-85536844 ATGCAGAAATAGAAAAGTGGGGG + Intergenic
1044183569 8:89224673-89224695 AGGTAGTAAAAGAAAAGAGAGGG + Intergenic
1044258109 8:90089926-90089948 AAATAGTAATAAAAATGTAAGGG - Intronic
1044323882 8:90838347-90838369 ATTTAGTATTAGAAATGTTTTGG - Intronic
1045130097 8:99141499-99141521 ATGTAATTCTAGAAATGTAATGG + Intronic
1045210768 8:100097052-100097074 ATTTAGAAATATAAATATGAGGG + Intronic
1046246499 8:111569924-111569946 CTGTAGTAATAGAAAACTAATGG - Intergenic
1046555801 8:115771606-115771628 ATGTTGTAATTGAAATTTGGAGG - Intronic
1048253876 8:132890222-132890244 AAATATTAATAGAAATGTGAAGG - Intronic
1048496455 8:134939887-134939909 ATGCACTAATAGAAACGGGAAGG + Intergenic
1049101243 8:140580448-140580470 GTGTGGTAAGAGAAATGGGAAGG + Intronic
1050149151 9:2601854-2601876 AGGTAGAAATAGAACAGTGATGG - Intergenic
1050252769 9:3762764-3762786 ATTTGGTAATGGAAATGTTATGG - Intergenic
1050451859 9:5790069-5790091 ATGTTGTAATAAAAATTGGATGG + Intronic
1050519726 9:6484712-6484734 ATTTATTAATAGAAATAAGAAGG - Intronic
1050884062 9:10741611-10741633 ATATAGTTATAGAAATGTTTTGG - Intergenic
1050978087 9:11967613-11967635 ACGTAGTAATATCAATGGGAAGG - Intergenic
1051067577 9:13123049-13123071 TTCTAGTAAAGGAAATGTGAAGG - Intronic
1051146012 9:14028039-14028061 CTGTAGAAATAGACATGTCAAGG - Intergenic
1051180876 9:14410868-14410890 CTGTATCAATAGAAATGAGAAGG - Intergenic
1051422765 9:16905022-16905044 ATGTAGTAAAAGATTTGGGAAGG + Intergenic
1051472323 9:17458832-17458854 ATAAAATATTAGAAATGTGAAGG + Intronic
1053639024 9:40049798-40049820 ATGTAGTCATATAAATGTTCAGG - Intergenic
1053767053 9:41415313-41415335 ATGTAGTCATATAAATGTTCAGG + Intergenic
1054319825 9:63646455-63646477 ATGTAGTCATATAAATGTTCAGG - Intergenic
1054545721 9:66326820-66326842 ATGTAGTCATATAAATGTTCAGG + Intergenic
1057019959 9:91689354-91689376 ATGTAGTAATGGCAAGGGGATGG - Intronic
1058123050 9:101159981-101160003 ATGTACTAAGAAAAATTTGATGG + Intronic
1058307903 9:103465664-103465686 ATGTAGTGATTGATATTTGAAGG + Intergenic
1058400940 9:104618388-104618410 ATGCAGGAAGAGAAATATGAGGG + Intergenic
1059858853 9:118434434-118434456 TTGTAGCCAAAGAAATGTGATGG + Intergenic
1061651137 9:132050881-132050903 ATGTAGTAATGAAAAAGTCAAGG - Intronic
1188008348 X:25033866-25033888 ATGAAGGAATAAAAATGTGCTGG - Intergenic
1188653114 X:32656063-32656085 ATGTAGTATTAGAAAGTTTAGGG + Intronic
1190129858 X:47737719-47737741 ATGTAGGAGTAAAAATATGAAGG + Intergenic
1192599780 X:72449633-72449655 ATGTAGTTATTGATATGTTAGGG - Intronic
1192666340 X:73091268-73091290 ATGTAGTAAAAGAAATGGCAAGG - Intergenic
1194937988 X:99974182-99974204 ATGTGGTGATAGAGATTTGAGGG - Intergenic
1195594273 X:106670512-106670534 AGGTAATATTTGAAATGTGAAGG + Intronic
1195604451 X:106787251-106787273 ATTTAGCAATAAAAGTGTGATGG + Intronic
1198097629 X:133395784-133395806 CTTTAGTAATAGAAATCTGTTGG - Intronic
1198804652 X:140481683-140481705 AGGTAGGAGTAGAAATGGGAAGG + Intergenic
1199134278 X:144232489-144232511 ATGTACCAATATAAATGTAAGGG - Intergenic
1199435701 X:147810204-147810226 ATGGACTAATACAAATGGGATGG + Intergenic
1201610107 Y:15832447-15832469 ATGTTGTAATACATATGTGTTGG - Intergenic