ID: 916295685

View in Genome Browser
Species Human (GRCh38)
Location 1:163216782-163216804
Sequence GTGATGGCCCTGAGAAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916295679_916295685 16 Left 916295679 1:163216743-163216765 CCATTGTGAGCATGCTGTGGGCT 0: 1
1: 0
2: 2
3: 16
4: 385
Right 916295685 1:163216782-163216804 GTGATGGCCCTGAGAAAGGGTGG 0: 1
1: 0
2: 5
3: 22
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916295685 Original CRISPR GTGATGGCCCTGAGAAAGGG TGG Intronic
900938836 1:5784757-5784779 CTGATGGCCCTGTGGGAGGGTGG - Intergenic
901017838 1:6242039-6242061 GTGGTGGCCCTGGGAACGGCGGG + Intergenic
901087441 1:6620041-6620063 GTGATGCGCCTGGGAAAGAGGGG + Exonic
901160197 1:7171465-7171487 GTGTTGGCCCTGAGATACTGGGG - Intronic
903662075 1:24984398-24984420 GGGATGGCCCTGAGGAACAGAGG + Intergenic
904497071 1:30893060-30893082 GGGATGGCCGTGATAAATGGTGG - Intronic
904824525 1:33265779-33265801 GGGAGGTCCCTGAGCAAGGGAGG - Intronic
905648294 1:39639730-39639752 GAAAGGGCCCTGGGAAAGGGCGG - Exonic
905717506 1:40165210-40165232 GTGATGGGACTGACAAGGGGAGG - Intronic
906301004 1:44681591-44681613 ATGAGGGCCCTGAGAAGGCGGGG + Intronic
906867552 1:49439261-49439283 GTGATAGCCATCAGAAAGTGTGG + Intronic
909074677 1:71039136-71039158 TCGATGGCCCTGAGAAGGGGAGG - Intronic
910419666 1:87045188-87045210 GTGATGCCCCAGAAAAAGTGGGG - Intronic
911158858 1:94662803-94662825 CAGATTGCCTTGAGAAAGGGAGG - Intergenic
911945298 1:104099869-104099891 GTGATTACCCTGGGAAAAGGTGG - Intergenic
912945461 1:114080716-114080738 GTGAGGGCCCAGAGAGAGTGGGG + Intergenic
916295685 1:163216782-163216804 GTGATGGCCCTGAGAAAGGGTGG + Intronic
916942745 1:169693255-169693277 GTGACGGCACTGAGGAAGGGTGG - Intronic
916949341 1:169763118-169763140 ATGCTGGGCCTAAGAAAGGGAGG - Intronic
918130024 1:181619347-181619369 GTGAAGGCCCTGAGGAAGGAGGG + Intronic
919867577 1:201793876-201793898 GTGAGAGGCCTGGGAAAGGGTGG + Intronic
920507050 1:206522681-206522703 GTGATGGCCAGGAGAAAATGTGG - Intronic
920544825 1:206807450-206807472 GTGAAGGCCCTGAGAGAAGAAGG - Intronic
920698061 1:208196790-208196812 GTGTTGTCCCTGAGAATGGGTGG + Intronic
920766644 1:208840032-208840054 GTGGTTGCCCTGTGAAAGGCAGG + Intergenic
921152889 1:212415646-212415668 GTGTTGGCCCTGTGGCAGGGTGG + Intergenic
921294740 1:213691150-213691172 GGGGTGGCCCTGAGCCAGGGAGG - Intergenic
923540328 1:234884167-234884189 GTGAAGGCCCCGAGAAAGGGTGG + Intergenic
924787810 1:247216502-247216524 AGACTGGCCCTGAGAAAGGGAGG + Intergenic
924943372 1:248827604-248827626 ATAAACGCCCTGAGAAAGGGAGG + Intergenic
1064009797 10:11726687-11726709 GTGAAGGCCCTGAAGAAGGAAGG + Intergenic
1069305203 10:66960795-66960817 GTGACTGCCCTTAGAAAAGGGGG + Intronic
1069860543 10:71468518-71468540 AGGATGGCCCTTAGAAAGTGTGG - Intronic
1070198165 10:74177697-74177719 TTGTTGTCCCAGAGAAAGGGAGG + Intronic
1070737297 10:78871996-78872018 GTAGTGGCCCTGGGAAGGGGTGG - Intergenic
1071299364 10:84245012-84245034 GGGATGGCCCTTTAAAAGGGAGG + Intergenic
1071515696 10:86295326-86295348 GTGATGGCCTGGAGCAAAGGAGG + Intronic
1071809895 10:89168017-89168039 GGCATGGCACTGAGAGAGGGAGG + Intergenic
1072663756 10:97379618-97379640 TTGATGGCTCTGAGTAAGTGTGG - Exonic
1073051586 10:100670715-100670737 GTGAGGGGCCTGAGTCAGGGAGG - Intergenic
1073315282 10:102576201-102576223 GCGAGGGCCCTGAGATTGGGTGG - Intronic
1073531645 10:104237956-104237978 ATGATGGTCCTGAGTAAAGGTGG + Intronic
1073805076 10:107088589-107088611 GAGCTGGCTCTGAGAAAAGGTGG - Intronic
1075037498 10:119081332-119081354 GGGATTGCCTTGAGAAATGGAGG + Intergenic
1075525119 10:123177656-123177678 TTGAGGCCCCTGAGAAATGGAGG + Intergenic
1075678878 10:124318299-124318321 GGCATGGCCCAGAGAATGGGAGG - Intergenic
1076521938 10:131086699-131086721 GCCATGGCCATGACAAAGGGTGG - Intergenic
1076648641 10:131971845-131971867 GGGATGTCCCTGAGAAAGCCTGG + Intronic
1077562536 11:3272885-3272907 GTGAGAGCTCTGAGCAAGGGAGG - Intergenic
1077568429 11:3318704-3318726 GTGAGAGCTCTGAGCAAGGGAGG - Intergenic
1077673900 11:4181089-4181111 GTCAGGGCCCTGAGGAAGAGGGG + Intergenic
1078436996 11:11333671-11333693 CTGATGCTCCTGAGAAAGGAGGG - Intronic
1079336495 11:19574958-19574980 GTGAAGGCCCTGAGGAGGGATGG + Intronic
1079506883 11:21162995-21163017 ATGATTGCACTGAGAAAGGAGGG + Intronic
1080214138 11:29822236-29822258 ATAATGGCCCTGAGAATGGCAGG + Intergenic
1081486187 11:43531290-43531312 GTGGTGGCACAAAGAAAGGGTGG - Intergenic
1082749046 11:56998392-56998414 GTGATTGCCCAGAGACAGGCTGG + Intergenic
1083155808 11:60822138-60822160 GTGGTGGCCCAGAGACAGAGAGG + Intergenic
1083159247 11:60844471-60844493 GTGAAGGCGCTGAGGAAGGAGGG - Intronic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1085125410 11:73998746-73998768 GTGATGATTCTGAGAAAGGGAGG - Intergenic
1088824784 11:113484364-113484386 CTGATGTCCCTGAGGCAGGGTGG - Intergenic
1089701256 11:120245464-120245486 GTGCTGCCCCAGAGAAGGGGGGG + Intronic
1089850982 11:121496266-121496288 TTGATGTCCTTCAGAAAGGGAGG - Intronic
1090043185 11:123308657-123308679 GTGCTGGCCCTGAAAATGAGAGG + Intergenic
1092257866 12:6937030-6937052 TTGAGGGCCCTGGGAAGGGGAGG - Exonic
1094377722 12:29809229-29809251 GTGATTGCCTAGAGCAAGGGAGG + Intergenic
1094874214 12:34622661-34622683 GTGATGGCCCAAATTAAGGGTGG + Intergenic
1096257727 12:50073318-50073340 TTGATGGCAGTGGGAAAGGGAGG - Intronic
1097726531 12:63081417-63081439 GTCCTGGCACTGAGAAAGGTGGG + Intergenic
1098014302 12:66088263-66088285 GTGATGCCCATGAGAAACGAGGG + Intergenic
1101780094 12:107827518-107827540 CTGACTGCCCTGAGAAATGGGGG - Intergenic
1102698412 12:114817856-114817878 CTGAGGGCCCTGGGAAAGTGGGG + Intergenic
1104497904 12:129257826-129257848 GAGATAACTCTGAGAAAGGGAGG + Intronic
1104672485 12:130690222-130690244 TGGTGGGCCCTGAGAAAGGGAGG - Intronic
1108808290 13:54186936-54186958 CTGAGGGCCCAGAAAAAGGGAGG + Intergenic
1111926167 13:94465042-94465064 ATGATGGCTCTGAGAAGGGGAGG - Intronic
1113615851 13:111680330-111680352 CTGAGGCCGCTGAGAAAGGGAGG - Intergenic
1113621319 13:111765223-111765245 CTGAGGCCGCTGAGAAAGGGAGG - Intergenic
1113759410 13:112837147-112837169 GTGATGGCCATGCAAAGGGGTGG - Intronic
1114400887 14:22409387-22409409 GTGATGGCCTAGAGATGGGGAGG + Intergenic
1116584987 14:46692134-46692156 GTGATAGCCCTGTGAAAGAATGG - Intergenic
1116944127 14:50820090-50820112 GTGATAGTCCTGAGAGTGGGGGG - Intronic
1117062212 14:51974593-51974615 GAGATGTCCCTCTGAAAGGGTGG - Intronic
1117679063 14:58184714-58184736 GTGATTGCCCTAGGAGAGGGGGG - Intronic
1121280004 14:92691313-92691335 GTGAGGGCCCTGAGAGAAGGTGG - Intergenic
1121286900 14:92743097-92743119 GTGAAGGCCCAGAGAGAGGAAGG - Intronic
1122985082 14:105208250-105208272 GTGAGGGCCAGGGGAAAGGGAGG - Intergenic
1124184855 15:27515616-27515638 GAGATGGCCATGAGAAAGAGAGG + Intronic
1126790703 15:52218679-52218701 TCCAAGGCCCTGAGAAAGGGAGG + Exonic
1129249777 15:74302523-74302545 GTGAGGCCCCCCAGAAAGGGCGG + Intronic
1129339432 15:74875344-74875366 GTAAAGGCCCTGAGACAGGAGGG - Intergenic
1129714120 15:77837092-77837114 ACGGTGGCCCAGAGAAAGGGAGG + Intergenic
1131137274 15:89947270-89947292 TTTATGGCCATGAGAAAGAGGGG - Intergenic
1132544055 16:524940-524962 GTGGTGGCCCAGAGAAAGGCGGG + Intergenic
1133819494 16:9223934-9223956 GTGTTGGCCCTGAGATGGAGAGG + Intergenic
1136002494 16:27305482-27305504 GTGATGGCCAAGAGGAAGGCAGG + Intergenic
1140186943 16:72782488-72782510 TTGATAGCCATGAGAAAGGTAGG - Intergenic
1140971091 16:80013462-80013484 GTGCTGGAGCTGAGAAAGTGTGG + Intergenic
1143153831 17:4823245-4823267 GGGAGGGCCCTGGGACAGGGAGG - Exonic
1143325415 17:6095268-6095290 GTGGTGGTCCTGAGAGAGGGGGG + Intronic
1143674503 17:8422078-8422100 GTGGGAGCCCTGAGAAAAGGTGG + Intronic
1145109066 17:20145749-20145771 GAGCTGGCCCTGAGAGAAGGTGG - Intronic
1147637764 17:41974376-41974398 GTGGTGGCTCTGAGAAGGGGAGG + Exonic
1148467488 17:47873649-47873671 GGGATGGCCCTGACGCAGGGAGG - Intergenic
1149370601 17:55990503-55990525 ATGATGGCTCTGAGAGAGGTGGG - Intergenic
1152316534 17:79583848-79583870 GTGGTGGCCATGGGAAAGGAGGG + Intergenic
1153564969 18:6410150-6410172 GAGACGGCCCTGAGACAGGAGGG - Intronic
1157177600 18:45465613-45465635 GATAGGGCCCTGAGGAAGGGAGG - Intronic
1158254490 18:55530546-55530568 GAGGTGGCCCTGAAAAGGGGGGG + Intronic
1158291970 18:55953437-55953459 GTGATGGCCCTGAGTATGGGAGG + Intergenic
1161091401 19:2361505-2361527 GTGAAGGGCCTGAGATGGGGTGG + Intergenic
1161195382 19:2983535-2983557 GTGAAGGCCCTGAGGCAGGACGG + Intronic
1161800985 19:6416684-6416706 GTGATGGCCCAGGGAAGAGGGGG + Intronic
1162856127 19:13469850-13469872 GAGAGGGTCCTGAGAAATGGCGG - Intronic
1163375351 19:16927022-16927044 GGGATGGGCCTGAGTCAGGGAGG - Intronic
1165240953 19:34466916-34466938 GTGATGCCCCGGAAAAAGTGGGG + Exonic
1165375192 19:35436992-35437014 GTGCTGACCCTGAGCCAGGGAGG - Intergenic
1165725679 19:38110928-38110950 GTGATGGCCCAGAGGAAAGTCGG + Intronic
1166043931 19:40218442-40218464 GTGAGGGGGCGGAGAAAGGGTGG - Intergenic
1167116612 19:47492512-47492534 GTGATGGCCGAGAAAAAGGCAGG - Intronic
1167161523 19:47770526-47770548 GTGCTGGCCCAGAGAGAGAGAGG + Intergenic
1167322414 19:48805414-48805436 CTGAGGGCTCTGAGGAAGGGAGG - Intronic
925427050 2:3758566-3758588 GTGTAGGACCTGAGACAGGGAGG + Intronic
925611372 2:5705767-5705789 GTGGAGGACCTGAGAAGGGGTGG + Intergenic
926181357 2:10646713-10646735 GTGGTGGCCCTGAGCAAGGGAGG - Intronic
926564047 2:14450622-14450644 CTGATAGACCTGAGAATGGGAGG + Intergenic
927135150 2:20091589-20091611 ATGATGGCCCTGACACAGCGGGG + Intergenic
927856362 2:26530204-26530226 GAGATGGCCCTGTGAAAGGGAGG + Intronic
928205322 2:29279578-29279600 GTGCTGGCCCAGAGACAGAGTGG + Intronic
929283986 2:40115069-40115091 ATGATGCCCCTGGGAATGGGAGG + Exonic
931250678 2:60528364-60528386 GTGAGGGTCCTGAGAAACAGAGG - Intronic
931997028 2:67848498-67848520 ATGATGGCTCTGGGAAAGAGAGG + Intergenic
932772071 2:74506049-74506071 GTGCTGGCTCTGAGAAAGATAGG + Exonic
935702877 2:105827801-105827823 GTGATGGTTGTCAGAAAGGGAGG + Intronic
935725528 2:106020839-106020861 GTGGAGGCCCTGAGAAACGTCGG - Intergenic
936384130 2:112013457-112013479 GTGAAGGCCATGAGAAATGTAGG - Intronic
936474038 2:112824226-112824248 GGGAAGGCCCTCTGAAAGGGTGG - Intergenic
936502433 2:113076992-113077014 GTGTTGGCCCTGAGACAGAAAGG + Intergenic
938295056 2:130172757-130172779 TTGGTGGCCCTGAGGTAGGGAGG - Intronic
938461571 2:131501078-131501100 TTGGTGGCCCTGAGGTAGGGAGG + Intergenic
939233061 2:139455221-139455243 GTGATGGCACTGCTACAGGGAGG - Intergenic
944158414 2:196633704-196633726 GTGTGTGCCCTGAGATAGGGTGG + Intergenic
946821158 2:223630829-223630851 GTGCTGGGCCTGAGAGAGCGGGG + Intergenic
948469522 2:238168097-238168119 GAGATGGTCCCGAGAAAGGGTGG + Intronic
1168913970 20:1471596-1471618 GTCATTGGCCTGAGAAAGTGGGG - Intronic
1168995788 20:2132218-2132240 CTGGTGGCCCTGAGACAGTGCGG - Intronic
1170584310 20:17722906-17722928 GGGATGGGGCTGTGAAAGGGAGG + Intronic
1170901245 20:20465500-20465522 GGGATGGAGCTGAGAGAGGGGGG + Intronic
1172458875 20:35099981-35100003 GTGATACCCCAGAAAAAGGGCGG - Intergenic
1172827736 20:37804755-37804777 GTCATGGCACTGAGAAGAGGAGG + Intronic
1173642522 20:44613954-44613976 GTGAAGGCTCTGAGGGAGGGAGG - Intronic
1175913162 20:62414148-62414170 CTGAGGGCCCTGAGAATGAGGGG - Exonic
1176288646 21:5032966-5032988 GTGATGGTCCTGATGACGGGGGG + Intronic
1176807288 21:13499170-13499192 GTTAAGTCCTTGAGAAAGGGGGG - Intergenic
1177627351 21:23680027-23680049 GTGAGTGCCCTGAGGAAGGAAGG - Intergenic
1178291292 21:31370905-31370927 GTGCTGGGTCTGAGAGAGGGCGG - Intronic
1179868538 21:44230509-44230531 GTGATGGTCCTGATGACGGGGGG - Intronic
1181001785 22:19991173-19991195 GGGGTGGCCCTGTGAAATGGAGG - Intronic
1181288518 22:21772505-21772527 GTGCTGGCCCTGAGGATGGCCGG - Intronic
1181391954 22:22589545-22589567 TTGATGCCCATGAGAAAGAGTGG - Intergenic
1181461697 22:23089578-23089600 GTGATAGCCCTGAGTCAGGATGG - Intronic
1183268414 22:36845467-36845489 GGGATGTCCCTGAGAAAGAATGG - Intergenic
1184628881 22:45759999-45760021 ATGATGGCCCTAAGAAAGGAAGG + Intronic
1184931164 22:47682325-47682347 GTGGTGCCCCTCAGCAAGGGTGG - Intergenic
950337031 3:12203237-12203259 GTGATGGCCCTGAAAGCAGGGGG + Intergenic
950676124 3:14555365-14555387 GACATGGCCCTGGGAAGGGGTGG + Intergenic
950962810 3:17123315-17123337 GTCATGGGGCAGAGAAAGGGAGG + Intergenic
953376506 3:42432767-42432789 GTGATGTCCGTGAGAAAGGGTGG - Intergenic
953517712 3:43612429-43612451 GTGGTATCCCTGAGAAAGGCAGG - Intronic
954790623 3:53130492-53130514 TTGATGGCCTTGAGAGAGGGGGG + Intergenic
955107604 3:55913755-55913777 ATGATGGGCATGAGCAAGGGAGG - Intronic
955158927 3:56445743-56445765 GTGAAGGCTCTGAGACAGGAAGG - Intronic
955796415 3:62641986-62642008 GAGATGGCACTGATAAAAGGAGG + Intronic
955876676 3:63497836-63497858 GTGATGAGCCTGAGTTAGGGAGG - Intronic
956152398 3:66257531-66257553 GGGATGGGCCTGGTAAAGGGAGG + Intronic
959242073 3:103808870-103808892 GTGAGTGCCCTCAGAAAGGGAGG + Intergenic
959974022 3:112437688-112437710 GTGATGGCAGTGAGAAAGATAGG - Intergenic
961459995 3:127044095-127044117 CTGATGGGACTGAGAAAGGTGGG + Intergenic
961479575 3:127171303-127171325 CTCAGGGACCTGAGAAAGGGAGG + Intergenic
962398759 3:135039681-135039703 CTGCTGGCCCCGAGCAAGGGGGG - Intronic
962853303 3:139323861-139323883 GTGATGACCCTGAGGAGGGGTGG - Intronic
963076786 3:141354603-141354625 GTGCTGACCATGAGCAAGGGAGG - Intronic
963327890 3:143881923-143881945 GAGATGGCCATGAGAAAGCATGG + Intergenic
964389557 3:156183272-156183294 GTGAGGGCTTTGAGAAGGGGTGG + Intronic
964916332 3:161846501-161846523 CTGACTGCCCTGAGAAATGGGGG - Intergenic
967109991 3:186284614-186284636 CTCATGGACCTGAGAAAGGCTGG - Intronic
967966410 3:194963671-194963693 AAGATGGCCCTGAGCAATGGGGG + Intergenic
968284838 3:197502417-197502439 CTGATGTCTCTGAGAAGGGGAGG + Intergenic
972782081 4:42294917-42294939 GTGATGGGCCTGAGAAACCAGGG + Intergenic
976970268 4:91094722-91094744 GCGATGGCCCTGAGTATGGGCGG - Intronic
977878675 4:102178987-102179009 GTGATGGCTCTGAGCAGGGTGGG - Intergenic
980724463 4:136740603-136740625 GTAAATGCCCTAAGAAAGGGAGG - Intergenic
985512340 5:319696-319718 GTGCTTGCCCTGAGACATGGGGG + Intronic
988833044 5:35005568-35005590 GTGCTGGCCCAGAGCAAGGTCGG - Intronic
991035591 5:62124454-62124476 GTGGGGGCCCTGAGCAACGGAGG + Intergenic
994278280 5:97866274-97866296 GTGATGGCACTGATAAACGAAGG - Intergenic
995691289 5:114829282-114829304 GTGAAGGTGCTGAGAATGGGTGG + Intergenic
998370408 5:141656983-141657005 GTGCTGGCCCTGGGATACGGTGG + Intronic
999908917 5:156174677-156174699 GTGAGGGCAATGAGAATGGGAGG + Intronic
1005819692 6:29587788-29587810 GTGATGAGCCTTGGAAAGGGAGG + Exonic
1005860610 6:29897037-29897059 AAGATGGCCCTAAGAAAGGAGGG - Intergenic
1007103417 6:39267268-39267290 GTGATGGCCCAGAGGGAAGGTGG - Intergenic
1012463187 6:99487103-99487125 GTGAATGCCCTCAGAAAGCGAGG + Intronic
1016252561 6:142062773-142062795 GTGATGCCCCAGAAAAAGTGGGG + Intronic
1017209038 6:151834785-151834807 GAGAAGGCGCTGAGACAGGGAGG + Intronic
1018948783 6:168365064-168365086 CTGAGAGCCCTGAGAAAGGGCGG - Intergenic
1021301601 7:18980110-18980132 ATGATGGCCCTGGGAAGAGGAGG - Intronic
1022418344 7:30197504-30197526 CTGATGGCCCTGAGAGAAAGGGG - Intergenic
1023177434 7:37448104-37448126 GTGATGGGCCAGAGGAATGGGGG - Intronic
1023822535 7:43988082-43988104 GTGGTGGCCCTCAGCAACGGTGG - Intergenic
1024376042 7:48639267-48639289 AGGATGGCACTGAGGAAGGGTGG - Intronic
1025745624 7:64240079-64240101 GTGTTGGCCCTGTGCAAAGGGGG + Intronic
1029750798 7:102541497-102541519 GTGGTGGCCCTCAGCAACGGTGG - Exonic
1029768753 7:102640608-102640630 GTGGTGGCCCTCAGCAACGGTGG - Exonic
1030886939 7:114950203-114950225 GTAATGCCTCTGAGAAAGGAAGG + Intronic
1031165216 7:118219753-118219775 TGGATGGTCCTGAGAAATGGGGG + Intronic
1032120250 7:129150144-129150166 GTGCGGGCCCTGAGACAGTGGGG + Intronic
1033004455 7:137546276-137546298 CTGATGGGCCTGAGCAAGGGAGG - Intronic
1033008186 7:137590277-137590299 GTCATGGCCCACAGAAAGGTGGG + Intronic
1033952078 7:146797168-146797190 TTGATTGCACTGAAAAAGGGTGG + Intronic
1034416744 7:150969268-150969290 CTCATGGCCCTGTGAAAGGCAGG - Intronic
1034974246 7:155438739-155438761 GGGATGGCCCTGAGAGTCGGGGG - Intergenic
1036010697 8:4719141-4719163 ATGATGGCCTGGAGAAAGGCAGG + Intronic
1038145126 8:24888324-24888346 GTGAAGGCCCTGAGGAGGGCAGG + Intergenic
1042819203 8:72911719-72911741 GAGATGGCCCTGTGAAAAGAAGG - Intronic
1043274768 8:78379228-78379250 GTGAAGGTCCTGAAAAAAGGAGG + Intergenic
1043358492 8:79441543-79441565 GTGGTGGCCCTTAAAAAGGGGGG + Intergenic
1045928688 8:107599471-107599493 GTGACTACCCTGAGAAATGGGGG - Intergenic
1048376578 8:133827899-133827921 GTGATAGCCATGAGAGATGGGGG + Intergenic
1048845416 8:138600276-138600298 GGGATGTAGCTGAGAAAGGGAGG + Intronic
1049249545 8:141580842-141580864 GTGATGGGACTGAGATGGGGCGG + Intergenic
1049258400 8:141625979-141626001 TAGATGGCCCTGAGAGAGAGTGG + Intergenic
1049445486 8:142628652-142628674 GAGAGGTCCCTGGGAAAGGGAGG + Intergenic
1049616941 8:143579658-143579680 GAGATGGGGCTGAGACAGGGAGG + Intergenic
1050126153 9:2358159-2358181 ATCATGCCCCTGAGAGAGGGAGG - Intergenic
1052827272 9:33186284-33186306 GGGATGGTCCTGGGAAAGGCAGG - Intergenic
1053543509 9:38998827-38998849 GTGAGGTCCCAGAGAACGGGAGG + Intergenic
1057208008 9:93184769-93184791 CTGGGGGCCCTGGGAAAGGGGGG - Intergenic
1058712880 9:107696268-107696290 GTGGTGTGCCTGAGAAAGGCAGG + Intergenic
1059448737 9:114356771-114356793 GTGATGGCCCAGAATAAGAGAGG - Intronic
1061879607 9:133562233-133562255 GAGATGGGCCCGAGAGAGGGAGG + Intronic
1062324420 9:136005329-136005351 GTGCTGGCCCTGAGAGCTGGGGG + Intergenic
1185909698 X:3970453-3970475 GTGATGGCCCCGAGTATGGGTGG + Intergenic
1186967745 X:14806164-14806186 GTGAGGACCCTGAGAAAGGAGGG + Intergenic
1190708123 X:53047904-53047926 CTGCTGGCCCCGAGAAAGTGGGG + Intergenic
1191617210 X:63182145-63182167 GTGGTGGCTCAGAGAAAGGAAGG - Intergenic
1191619088 X:63196778-63196800 GTGGTGGCTCAGAGAAAGGAAGG + Intergenic
1192349595 X:70346395-70346417 GTGATGGCCATGAACAATGGTGG - Intronic
1195571624 X:106403407-106403429 GTCATGGACCTGAGATAGGAAGG - Intergenic
1196934541 X:120716515-120716537 GTGAGGACTCAGAGAAAGGGAGG - Intergenic
1198486989 X:137097290-137097312 GAGATGGCACAAAGAAAGGGTGG + Intergenic
1198936366 X:141905052-141905074 ATGATGGCTCTGACAAAGGCCGG - Exonic
1200780335 Y:7209897-7209919 CTGCTGGCCCTGAGGAAGGTGGG + Intergenic
1201554873 Y:15257311-15257333 GTGATGGCCCCAAGTATGGGTGG + Intergenic