ID: 916299797

View in Genome Browser
Species Human (GRCh38)
Location 1:163261317-163261339
Sequence CTTTATGTATGAGCAGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 350}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916299797 Original CRISPR CTTTATGTATGAGCAGGAAG GGG (reversed) Intronic
901720178 1:11191113-11191135 CTGTTTGGATGAGCAGGAAGTGG - Intronic
905516312 1:38564578-38564600 CTTTTTGTAGGTGCAGGATGTGG + Intergenic
905641490 1:39593010-39593032 CATGAGGTATGAGCAGGATGTGG - Intergenic
905778137 1:40683850-40683872 CTTTATTTATTCTCAGGAAGTGG + Intergenic
905978917 1:42204945-42204967 ATTTATGTGTGTGCATGAAGTGG + Intronic
909153120 1:72034358-72034380 CTTTTTAGATGAGCAGGAAAGGG + Intronic
911604005 1:99880576-99880598 CATTATTTATGTCCAGGAAGAGG - Intronic
913932875 1:125000329-125000351 CTTTTTGTAGGATCTGGAAGTGG + Intergenic
913936099 1:125050098-125050120 CTTTTTGTATGATCTGCAAGTGG + Intergenic
915047598 1:153031469-153031491 CTTTCTGTGTCAGCAAGAAGGGG + Intronic
915327642 1:155088995-155089017 GTTGATGTATGAGCAGAAATTGG + Intergenic
916299797 1:163261317-163261339 CTTTATGTATGAGCAGGAAGGGG - Intronic
917478379 1:175388211-175388233 CTTTATCCATGAGAAAGAAGGGG + Intronic
919125767 1:193391312-193391334 CTTTATGTTTCAGAAGAAAGAGG + Intergenic
919191650 1:194229214-194229236 TTTTATGAACGAGCTGGAAGAGG - Intergenic
920095776 1:203485750-203485772 ATTTATGGAGGAGCAGGAGGAGG - Intronic
1065782227 10:29180569-29180591 ATTTTTGAATGGGCAGGAAGTGG - Intergenic
1066472171 10:35709830-35709852 CTTTCTGTTTGTGGAGGAAGGGG + Intergenic
1067714695 10:48681663-48681685 CTTTATGTATTACAAGGAATTGG + Intergenic
1068560356 10:58508357-58508379 CTTTGTGTAAGGGGAGGAAGTGG - Intergenic
1071682309 10:87718504-87718526 CTTTCTGCATGAGCAGGTAGGGG - Intronic
1072910616 10:99497666-99497688 CTGTGTTTATGAGAAGGAAGAGG - Intergenic
1075471836 10:122696867-122696889 CTGTATGCCTGGGCAGGAAGTGG + Intergenic
1077603448 11:3590384-3590406 CTTTCTGCATGTCCAGGAAGAGG - Intergenic
1082321751 11:50820463-50820485 CTTTTTGTAGGAGCTGCAAGTGG + Intergenic
1082451351 11:52961322-52961344 CTTTCTGTATAATCAGCAAGTGG + Intergenic
1082766841 11:57175671-57175693 CTTTCTGTGTGTGCAGGAAATGG - Intergenic
1084259349 11:67964929-67964951 CTTTCTGCATGTCCAGGAAGAGG - Intergenic
1084603137 11:70158463-70158485 GTTTCTGTATCAGCAGGAGGGGG - Intronic
1085532208 11:77198550-77198572 CTTTGTGGATGAGCAGGAGCAGG + Exonic
1086074491 11:82835568-82835590 CTTTATGTTAGATGAGGAAGGGG + Intronic
1087416427 11:97861999-97862021 CTTTATCTAGGACCAGAAAGTGG + Intergenic
1088093667 11:106074131-106074153 CTTAATGTATGAGAAGGAAGGGG - Intronic
1088128511 11:106458808-106458830 CTGTGTGTATCAGCAGGAAAAGG + Intergenic
1088295810 11:108292760-108292782 CCTTGTGTATGAGCAGGTGGAGG + Exonic
1089330017 11:117682628-117682650 CTTTATGCATGGGCTGGAGGGGG - Intronic
1090701939 11:129304324-129304346 CTTCAAGAATGAGAAGGAAGAGG + Intergenic
1091942897 12:4505596-4505618 TTTTATGTATGAGGAGACAGAGG + Intronic
1093595032 12:20949532-20949554 CTTTATGTATCAGAAAGAAAGGG - Intergenic
1095058347 12:37647545-37647567 CTTTTTGTATAATCTGGAAGTGG + Intergenic
1095065649 12:37769421-37769443 CTTTTTGTATGATCTGTAAGTGG + Intergenic
1098540135 12:71645962-71645984 CTTTATGTATGTGCATGGAAGGG + Intronic
1099335708 12:81354433-81354455 TTTTATGAATGAACAGAAAGTGG - Intronic
1099378772 12:81929303-81929325 CTTTTTCCATGAGCAGGAAAAGG + Intergenic
1099832269 12:87859043-87859065 CTTTATTTTTGAGGAGGAACGGG - Intergenic
1100593825 12:96054584-96054606 ATTTATATATGAGAAGGAACTGG + Intergenic
1101303071 12:103501590-103501612 CTTTATCTTTGAGCAAGAACAGG - Intergenic
1102132805 12:110545839-110545861 CATTAAGTGTGAGCAGGACGTGG - Intronic
1105089347 13:16258985-16259007 CTTTTTGTAGGAGCTGCAAGTGG + Intergenic
1105104292 13:16506888-16506910 CTTTTTGTAGTATCAGGAAGTGG + Intergenic
1105126491 13:16869316-16869338 CTTTTTGTATTATCTGGAAGTGG + Intergenic
1105154339 13:17324357-17324379 CTTTTTGTAGTATCAGGAAGTGG + Intergenic
1105175048 13:17653267-17653289 CTTTTTGTATTGGCTGGAAGTGG + Intergenic
1105179213 13:17717707-17717729 CTTTCTGTATTATCTGGAAGTGG + Intergenic
1106522138 13:30507233-30507255 CTTATGGGATGAGCAGGAAGTGG - Intronic
1107273239 13:38645157-38645179 CTTGATATAAAAGCAGGAAGTGG - Intergenic
1108761242 13:53568356-53568378 CTTTAAGCATGGGCAGGAGGGGG - Intergenic
1109280561 13:60350447-60350469 CTTTTTATATGAGCAGGCAATGG - Intergenic
1109557910 13:64004626-64004648 TTTTGTATATGAGGAGGAAGGGG + Intergenic
1109621126 13:64906752-64906774 CTTTATGTATTAAAAGTAAGTGG + Intergenic
1110163067 13:72402521-72402543 CTTTACGTAGCAGCAGGAAAGGG + Intergenic
1110428449 13:75395950-75395972 CTTTATTTATAAGCAGGATCAGG + Intronic
1111073561 13:83202033-83202055 ATTTATGAATGAGAAGGAATAGG + Intergenic
1113528409 13:111000769-111000791 CTTGATGTGTGAGCATGGAGAGG - Intergenic
1113999490 14:16139841-16139863 CTTTTTGTAGGAGCTGCAAGTGG - Intergenic
1114000453 14:18235874-18235896 CTTTTTGTAGGATCTGGAAGTGG - Intergenic
1114002661 14:18275972-18275994 CTTTTTATAGGAGCAGCAAGTGG - Intergenic
1117149093 14:52867054-52867076 CTTTATCTATGACAAGGAAGGGG - Intronic
1118687458 14:68305346-68305368 CTTTATGTTTGAGAGGGGAGAGG - Intronic
1120646707 14:87082871-87082893 GCTTATGTATGAGGAGGAGGAGG - Intergenic
1122125476 14:99576352-99576374 CTGCATGTCAGAGCAGGAAGGGG - Intronic
1123110443 14:105864652-105864674 GTTTATGTCTGGGCAGGAACAGG - Intergenic
1124819358 15:33029138-33029160 CTTTATGTATTTTGAGGAAGGGG - Intronic
1124903548 15:33846770-33846792 TTTTATGTATGAGAAGATAGAGG - Intronic
1127751846 15:62053522-62053544 CTCTATGAATGCGGAGGAAGTGG + Intronic
1127950977 15:63806074-63806096 CTTTAGCAATGAACAGGAAGTGG - Intronic
1130726108 15:86441392-86441414 CATTTTGTTTGAGCAGGAATTGG - Intronic
1131933099 15:97467971-97467993 ATTTATGTATCTGCAGGAGGGGG + Intergenic
1132016743 15:98324571-98324593 CCTTATGTATGACCAGGAGGTGG + Intergenic
1135134352 16:19876594-19876616 CTGCATGGCTGAGCAGGAAGTGG - Intronic
1135204474 16:20471376-20471398 GTCTATGTATAAGTAGGAAGGGG - Intronic
1135214412 16:20552435-20552457 GTTTAAGTATAAGTAGGAAGGGG + Intronic
1135792416 16:25409339-25409361 CATAATGTATGAGCAGGACTGGG + Intergenic
1135843226 16:25895252-25895274 GTTAATGTATGACCAGGTAGAGG + Intronic
1136917893 16:34227916-34227938 CTTTTTGTATTATCTGGAAGTGG + Intergenic
1136919592 16:34253568-34253590 CTTTTTGTAGTATCAGGAAGTGG + Intergenic
1137078340 16:36006559-36006581 CTTTTTGTAGGATCTGGAAGTGG + Intergenic
1137080444 16:36045341-36045363 CTTTTTGTAGGATCTGGAAGTGG + Intergenic
1137095953 16:36257196-36257218 CTTTTTGTAGGATCTGGAAGTGG - Intergenic
1137098033 16:36335421-36335443 CTTTTTGTAGGATCTGGAAGTGG - Intergenic
1145468158 17:23496784-23496806 CTTTTTGTAGGATCTGGAAGTGG + Intergenic
1145616250 17:25651464-25651486 CTTTTTGTAGGATCTGGAAGTGG + Intergenic
1145654454 17:26206041-26206063 CTTTTTGTAGGATCTGGAAGTGG + Intergenic
1146570715 17:33950334-33950356 CTTTTTGTGTGTGGAGGAAGAGG - Intronic
1146641082 17:34541861-34541883 CTTCAGGTCTGAGCAGGAGGGGG + Intergenic
1150222326 17:63503189-63503211 CTTTGCGTAGGAGAAGGAAGAGG - Intronic
1150222457 17:63504491-63504513 CTTTGTGTAGGAGAAGAAAGAGG - Intronic
1151142288 17:72005274-72005296 CTTTTTGTGTGAGGAGGAAGCGG - Intergenic
1151244863 17:72786670-72786692 GCTTCTGTATGGGCAGGAAGTGG + Intronic
1151309628 17:73285447-73285469 CTTCATGGATGAGGAGGAGGAGG - Exonic
1152141324 17:78538505-78538527 ATTTGTCTATGAGCAGGAGGGGG + Intronic
1154347405 18:13553796-13553818 CTTCATGTATGAACAGTAAAGGG - Intronic
1154350513 18:13579487-13579509 CTTCATGGATGACCAGTAAGGGG + Intronic
1154534402 18:15384699-15384721 CTTTTTATAGGAGCAGCAAGTGG + Intergenic
1154563351 18:15860377-15860399 CTTTTTGTATTATCTGGAAGTGG + Intergenic
1154579389 18:16079953-16079975 CTTTTTGTATTATCTGGAAGTGG + Intergenic
1154583381 18:16134771-16134793 CTTTTTGTATTATCTGGAAGTGG + Intergenic
1154599923 18:16360926-16360948 CTTTTTGTATTATCTGGAAGTGG + Intergenic
1154600225 18:16364996-16365018 CTTTTTGTATTATCTGGAAGTGG + Intergenic
1154603639 18:16411651-16411673 CTTTTTGTATTATCTGGAAGTGG + Intergenic
1154626973 18:16732190-16732212 CTTTTTGTATTATCTGGAAGTGG + Intergenic
1154668850 18:17306517-17306539 CTTTTTGTATTATCTGGAAGTGG + Intergenic
1154700871 18:17745030-17745052 CTTTTTGTATTATCTGGAAGTGG + Intergenic
1154760162 18:18557677-18557699 CTTTTTGTATTATCTGGAAGTGG + Intergenic
1154775317 18:18765794-18765816 CTTTTTGTATTATCTGGAAGTGG + Intergenic
1154809196 18:19231278-19231300 CTTTTTGTATTATCTGGAAGTGG + Intergenic
1154815250 18:19314555-19314577 CTTTTTGTATTATCTGGAAGTGG + Intergenic
1154825446 18:19455363-19455385 CTTTTTGTATTATCTGGAAGTGG + Intergenic
1154861239 18:19949538-19949560 CTTTATGTAGTATCTGGAAGTGG + Intergenic
1154883170 18:20251747-20251769 CTTTTTGTATTATCTGGAAGTGG + Intergenic
1154908607 18:20613199-20613221 CTTTTTGTACTATCAGGAAGTGG + Intergenic
1154909122 18:20621359-20621381 CTTTTTGTACTATCAGGAAGTGG + Intergenic
1154909551 18:20627945-20627967 CTTTTTGTACTATCAGGAAGTGG + Intergenic
1154909965 18:20634406-20634428 CTTTATGTAGTATCTGGAAGAGG + Intergenic
1154910753 18:20646882-20646904 CTTTTTGTACTATCAGGAAGTGG + Intergenic
1154910912 18:20649438-20649460 CTTTTTGTACTATCAGGAAGTGG + Intergenic
1154912382 18:20672526-20672548 CTTTTTGTACTATCAGGAAGTGG + Intergenic
1154913043 18:20682915-20682937 CTTTTTGTACTATCAGGAAGTGG + Intergenic
1154921690 18:20816376-20816398 CTTTTTGTACTATCAGGAAGTGG - Intergenic
1154921811 18:20818423-20818445 CTTTATGTAGTATCTGGAAGAGG - Intergenic
1154923181 18:20840049-20840071 CTTTTTGTACTATCAGGAAGTGG + Intergenic
1154923392 18:20843451-20843473 CTTTTTGTACTATCAGGAAGTGG + Intergenic
1154923598 18:20846854-20846876 CTTTTTGTACTATCAGGAAGTGG + Intergenic
1154924057 18:20854142-20854164 CTTTTTGTACTATCAGGAAGTGG + Intergenic
1154925232 18:20922907-20922929 CTTTTTGTACTATCAGGAAGTGG + Intergenic
1156045312 18:32871241-32871263 CTTCATGTAAGAGAAGTAAGGGG - Intergenic
1156088242 18:33434834-33434856 CTAGATGTAGGAGAAGGAAGAGG + Intronic
1156149824 18:34227814-34227836 CTTTATGTAAGTGCTGGGAGGGG + Intergenic
1156282850 18:35657903-35657925 ATTTATGTATGTTCAGGAAGAGG + Intronic
1156329889 18:36110953-36110975 CTTTTTGGGGGAGCAGGAAGTGG - Intronic
1156744834 18:40377273-40377295 CTTTATTAATGAGCTGAAAGAGG - Intergenic
1157681387 18:49610060-49610082 CTTAATGTATGATGAGGAACAGG + Intergenic
1159545160 18:69831427-69831449 TTTTATGTGTCAGCAGGAATGGG - Intronic
1159826755 18:73222297-73222319 GTTGATGTATGAACTGGAAGAGG - Intronic
1166866821 19:45843644-45843666 CTTTAAGAATGAGCAGGCTGAGG + Intronic
1167935184 19:52900035-52900057 CTGTATTTATGGGCAGTAAGAGG + Intergenic
925668990 2:6291508-6291530 CATGATGTAAAAGCAGGAAGGGG + Intergenic
926304284 2:11626886-11626908 GTTTCTGTTTGAGCAGGCAGGGG + Intronic
926999970 2:18784310-18784332 TTTTATGTATGAGGTGGAGGAGG + Intergenic
927333099 2:21889468-21889490 CTTCAGTTATGAGAAGGAAGAGG + Intergenic
928260987 2:29766492-29766514 CTTGATGAATGAACAGGAGGTGG - Intronic
928333572 2:30376578-30376600 GTTTCTGTAAGAGCAAGAAGTGG - Intergenic
929393014 2:41493776-41493798 CTTTATAGATGAGCTTGAAGAGG - Intergenic
929522620 2:42668085-42668107 GGTTATGGATGGGCAGGAAGAGG + Intronic
930276669 2:49319213-49319235 CTTTATGTACCAGTAGGAAAGGG + Intergenic
932329009 2:70886940-70886962 CTTACTGTTTCAGCAGGAAGGGG - Intergenic
934347887 2:92375014-92375036 CTTTTTGTATTATCTGGAAGTGG + Intergenic
934348883 2:92390991-92391013 CTTTTTGTAGTATCAGGAAGTGG + Intergenic
934351783 2:92436700-92436722 CTTTTTGTATTATCTGGAAGTGG + Intergenic
934353554 2:92464224-92464246 CTTTTTGTAGGATCTGGAAGTGG + Intergenic
934356121 2:92505003-92505025 CTTTATGTAGTATCTGGAAGTGG + Intergenic
934374097 2:92792654-92792676 CTTTTTGTAGGATCTGGAAGTGG + Intergenic
934374543 2:92799953-92799975 CTTTTTGTAGGATCTGGAAGTGG + Intergenic
934386642 2:92994186-92994208 CTTTTTGTATTATCTGGAAGTGG + Intergenic
934391138 2:93066871-93066893 CTTTTTGTATTATCTGGAAGTGG + Intergenic
934394492 2:93121000-93121022 CTTTTTGTAGGATCTGGAAGTGG + Intergenic
934403569 2:93268581-93268603 CTTTTTGTAGTAGCTGGAAGTGG + Intergenic
934408272 2:93343665-93343687 CTTTTTGTAGTAGCTGGAAGTGG + Intergenic
934410362 2:93376978-93377000 CTTTTTGTAGGATCTGGAAGTGG + Intergenic
934415134 2:93454076-93454098 CTTTTTGTAGTAGCTGGAAGTGG + Intergenic
934416180 2:93471193-93471215 CTTTTTGTATCATCTGGAAGTGG + Intergenic
934417809 2:93497174-93497196 CTTTTTGTAGTAGCTGGAAGTGG + Intergenic
934450208 2:94019006-94019028 CTTTTTGTAGGATCTGGAAGTGG + Intergenic
934451678 2:94042941-94042963 CTTTTTGTAGTAGCTGGAAGTGG + Intergenic
934469863 2:94512976-94512998 CTTTTTGTAGGATCTGGAAGAGG - Intergenic
934700678 2:96437516-96437538 CTTTGTGTAAGAGAAGTAAGAGG + Intergenic
935396563 2:102616170-102616192 CTGTATGAAGGAGCAGGTAGAGG - Intergenic
936514939 2:113175400-113175422 CTTTCTGTGTGGGCAGGATGTGG + Intronic
938533213 2:132213084-132213106 CTTTTTATAGGAGCAGCAAGTGG + Intronic
938535674 2:132241450-132241472 CTTTTTGTATTATCTGGAAGTGG + Intronic
939471024 2:142620044-142620066 CTTTCTGAATGAGCAGGAAAAGG - Intergenic
940879187 2:158929453-158929475 CTTTAAGGATGAGCAGGAGGAGG - Intergenic
941769405 2:169329186-169329208 CTTTGTGAATGAGCAGGATTTGG + Intronic
941853504 2:170207440-170207462 TTTTATGTTTGCACAGGAAGAGG + Intronic
942518201 2:176775290-176775312 ATTTAGTTATGAGCAGGATGAGG - Intergenic
943403882 2:187454667-187454689 TTTTATGTATAAGAAGGCAGAGG + Intergenic
943994965 2:194750967-194750989 CAGTATGTTTGAGCAAGAAGAGG - Intergenic
944313585 2:198262072-198262094 CTTTATGTTTGAGGAGGATGTGG - Intronic
944890068 2:204108484-204108506 CTTTATGAATGGACAGGAGGGGG - Intergenic
946112760 2:217434620-217434642 CTGTATGTATTAGCATGAACAGG + Intronic
1168807541 20:681315-681337 CTTTATGGATGTGCAGGGTGAGG - Intergenic
1170161975 20:13322598-13322620 CTTTCTGTTTGAGCAGGAAAAGG - Intergenic
1171577902 20:26356495-26356517 CTTTTTGTATTATCTGGAAGTGG + Intergenic
1171734141 20:28750626-28750648 CTTTTTGTAGGATCTGGAAGTGG + Intergenic
1171738572 20:28829617-28829639 CTTTTTGTATAATCTGGAAGTGG + Intergenic
1171740377 20:28877842-28877864 CTTTATGTAGAATCAGCAAGTGG - Intergenic
1173070536 20:39760404-39760426 CTATATGTATCTGAAGGAAGAGG + Intergenic
1173401128 20:42726855-42726877 TTTTGTGTGTGAGCAGGGAGAGG + Intronic
1174190483 20:48736971-48736993 CTTTATGGATGAGAATGCAGAGG - Intronic
1174882508 20:54295885-54295907 CTTGATGTATGAGCTGGACAAGG + Intergenic
1178119435 21:29453203-29453225 CTGAATGTAAGAGAAGGAAGAGG - Intronic
1179521971 21:41951605-41951627 CTTTGTGTGGGAGCAGGGAGGGG - Intronic
1179566307 21:42251241-42251263 CTTTAGGTTTGGGCAGGAAAGGG + Intronic
1180424917 22:15165647-15165669 CTTTTTGTAGGATCTGGAAGTGG - Intergenic
1180427175 22:15206766-15206788 CTTTTTATAGGAGCAGCAAGTGG - Intergenic
1180510434 22:16080980-16081002 CTTTTTATAGGAGCAGCAAGTGG - Intergenic
1182550305 22:31097308-31097330 CTTCTTGGATGAGGAGGAAGAGG - Exonic
1183052173 22:35272145-35272167 ATTTATATAAGAGAAGGAAGAGG + Intronic
1184277263 22:43416548-43416570 CTTGATATATAAGCGGGAAGGGG + Intronic
1202719200 2_KI270715v1_random:51598-51620 CTTTTTGTAGTAGCTGGAAGTGG + Intergenic
1202719782 2_KI270715v1_random:60772-60794 CTTTTTGTAGTAGCTGGAAGTGG + Intergenic
1202719822 2_KI270715v1_random:61452-61474 CTTTTTGTAGTAGCTGGAAGTGG + Intergenic
1202719950 2_KI270715v1_random:63492-63514 CTTTTTGTAGTAGCTGGAAGTGG + Intergenic
1202720077 2_KI270715v1_random:65532-65554 CTTTTTGTAGTAGCTGGAAGTGG + Intergenic
1202720161 2_KI270715v1_random:66892-66914 CTTTTTGTAGTAGCTGGAAGTGG + Intergenic
1202720311 2_KI270715v1_random:69270-69292 CTTTTTGTAGTAGCTGGAAGTGG + Intergenic
1202720467 2_KI270715v1_random:71647-71669 CTTTTTGTAGTAGCTGGAAGTGG + Intergenic
1202722826 2_KI270715v1_random:109033-109055 CTTTTTGTAGGATCTGGAAGTGG + Intergenic
1202722916 2_KI270715v1_random:110393-110415 CTTTTTGTAGGATCTGGAAGTGG + Intergenic
950984630 3:17348305-17348327 CTTAATATATTAGCAGGCAGTGG - Intronic
951283592 3:20781735-20781757 GTTTATGTATTAGCTGGTAGTGG - Intergenic
951834102 3:26961904-26961926 CTTTGAATAGGAGCAGGAAGAGG - Intergenic
951912571 3:27767127-27767149 CTTTCTGAATGGGCAGGAAGAGG + Intergenic
953262359 3:41352236-41352258 ATTTGTGGAGGAGCAGGAAGGGG - Intronic
953595588 3:44309655-44309677 CTGTATGGCTGAACAGGAAGGGG + Intronic
957074302 3:75589456-75589478 CTTTCTGCATGTCCAGGAAGAGG - Intergenic
957765190 3:84615306-84615328 CTGTACTTATTAGCAGGAAGAGG + Intergenic
958206266 3:90399248-90399270 CTTTATGTATTATCTGCAAGTGG - Intergenic
958220201 3:90661362-90661384 CTTTATGTATTATCCGCAAGTGG - Intergenic
958221200 3:90683181-90683203 CTTTATGTATTATCTGCAAGTGG - Intergenic
958973516 3:100639560-100639582 CTTGACATATGAGAAGGAAGTGG + Intronic
959572183 3:107896588-107896610 TTTTATAAATGATCAGGAAGAGG - Intergenic
960764881 3:121114962-121114984 CTTTATGTTGGAACAGAAAGAGG + Exonic
961279797 3:125757286-125757308 CTTTCTGCATGCCCAGGAAGAGG + Intergenic
961874601 3:130012298-130012320 CTTTCTGCATGTCCAGGAAGAGG - Intergenic
964083541 3:152789053-152789075 ATTTATATATGCGCAGCAAGAGG - Intergenic
964541992 3:157789840-157789862 CTTTTTGTATGACTAGGATGGGG - Intergenic
964729227 3:159847233-159847255 CGTTATGTATGTGCATGAATAGG - Intronic
965067098 3:163864150-163864172 GTTTATATAGGAGCAGGATGGGG - Intergenic
965449492 3:168820104-168820126 ATTTAGGAATGAGCAAGAAGAGG + Intergenic
966956813 3:184889429-184889451 GTGTATGTAAGAGCAGGAGGAGG - Intronic
967234338 3:187369462-187369484 CTTGAAGGATGAGCAGGGAGGGG - Intronic
968089814 3:195892950-195892972 CTTTGTGTATGGGGAGGCAGGGG - Intronic
969017921 4:4117059-4117081 CTTTCTGCATGTCCAGGAAGAGG - Intergenic
969736077 4:8991635-8991657 CTTTCTGCATGTTCAGGAAGAGG + Intergenic
970016700 4:11520031-11520053 CTTTTGGTATGAGCAGAAAATGG - Intergenic
970402487 4:15731204-15731226 CCTTGTGTGTGAGCAGGGAGGGG + Intronic
970658044 4:18253706-18253728 CCTGATGTTTGAGCAGGAGGAGG + Intergenic
972901346 4:43687894-43687916 CTTTAGGTCTGAATAGGAAGTGG - Intergenic
973429844 4:50130929-50130951 CTTTCTGTATTATCTGGAAGTGG + Intergenic
973464180 4:50698336-50698358 CTTTCTGTATTATCTGGAAGTGG + Intergenic
973519664 4:51613052-51613074 CTTTCTGTATTATCTGGAAGTGG + Intergenic
974940198 4:68458551-68458573 GTTTATGTATGTTCAGGAGGAGG + Intronic
975596820 4:76055170-76055192 CTTTCAGTATGAGCAGTAAAAGG + Intronic
977468105 4:97407267-97407289 TTACATGTATGAGAAGGAAGTGG - Intronic
977613198 4:99058131-99058153 CTTGATGTAGGAGAGGGAAGAGG + Intronic
977662107 4:99601278-99601300 TTTTATGTATGAGTAAAAAGGGG - Intronic
979037582 4:115744431-115744453 CTTGATGTAGGAACAGGAAATGG + Intergenic
980460986 4:133113064-133113086 CTGTATGTATGAAGCGGAAGTGG - Intergenic
981223545 4:142265011-142265033 TTCTGTGTATAAGCAGGAAGGGG - Intronic
981549175 4:145925576-145925598 CTTAATGAATGAGCACCAAGTGG + Intronic
982193867 4:152888839-152888861 CTGTAGGTTTCAGCAGGAAGTGG + Intronic
984940666 4:184929550-184929572 ATTTTTGTGTGAGCAGCAAGGGG - Intergenic
988394180 5:30676000-30676022 CTTTATGTAATTGCAGAAAGAGG + Intergenic
989807638 5:45630038-45630060 TTTTAGGTATTAGCAGGAACTGG - Intronic
989858240 5:46328183-46328205 CTTTTTGTAGGATCTGGAAGTGG - Intergenic
989858458 5:46332104-46332126 CTTTTTGTAGGATCTGGAAGTGG - Intergenic
989860310 5:46365834-46365856 CTTTCTGTAGGAACAGCAAGTGG + Intergenic
989860381 5:46367199-46367221 CTTTTTGTAGGATCTGGAAGTGG + Intergenic
989943429 5:50184337-50184359 CTTTTTGTATGATCTGTAAGTGG - Intergenic
989946596 5:50240530-50240552 CTTTATGTAGAAGCTGAAAGTGG - Intergenic
992637686 5:78740570-78740592 CTTTATATAAGAGGGGGAAGGGG - Intronic
992653004 5:78879738-78879760 ATTTCTGTATCAGCAGGCAGGGG + Intronic
992772474 5:80061107-80061129 CTTTCTGAAAGGGCAGGAAGTGG + Intronic
993130409 5:83890279-83890301 CTTTATGCATGAGCAGAGAAAGG - Intergenic
993827567 5:92710381-92710403 TTATATGTATGAGGAGGAAATGG + Intergenic
993849761 5:92992198-92992220 CTTTATTTTTGTGCTGGAAGAGG + Intergenic
994548055 5:101194098-101194120 CTTCATGTCTTAGCAGGAAATGG + Intergenic
997211082 5:132077151-132077173 CTTTCTGCATGAGCATGGAGTGG - Intergenic
997752916 5:136366003-136366025 CATTATCTAGGATCAGGAAGAGG + Intronic
998413901 5:141931426-141931448 CTTTAAGCAGGAGCAGGAAAGGG + Intronic
999042217 5:148427197-148427219 CTTTTTCTATAAGCAGTAAGTGG + Exonic
1202773849 5_GL000208v1_random:41958-41980 CTTTATGTAGGATCTGCAAGTGG - Intergenic
1202774030 5_GL000208v1_random:45852-45874 CTTTTTGTATAATCAGCAAGTGG - Intergenic
1202775272 5_GL000208v1_random:64190-64212 CTTTTTGTATGATCTGAAAGTGG - Intergenic
1004999142 6:21223539-21223561 TATTTTGTATGAGAAGGAAGAGG + Intronic
1009730752 6:67602471-67602493 CCTTATGAAGGAACAGGAAGAGG + Intergenic
1010653570 6:78483962-78483984 CTTTATGTATGTGTATGGAGAGG - Intergenic
1011127947 6:84027137-84027159 CTGTATGTATGAGCCTGCAGAGG + Intergenic
1013216984 6:108036697-108036719 CTTTATGTAAGAGAAGGACCTGG - Intergenic
1014943645 6:127472319-127472341 CTTTAGGTTTGAGGAGAAAGGGG + Intronic
1016716091 6:147231154-147231176 GTTAATGAATAAGCAGGAAGAGG - Intronic
1016974061 6:149790008-149790030 CTTGATGTAGGATCTGGAAGTGG + Exonic
1017780737 6:157713495-157713517 CTCCATGGATGAGCAAGAAGCGG - Intronic
1020383316 7:7569240-7569262 ATTTAAGAATGAGGAGGAAGAGG - Intronic
1024463920 7:49689134-49689156 CTTTATGTTTCAGGAGGAGGGGG - Intergenic
1025312953 7:57974170-57974192 CTTTTTGTAGGATCTGGAAGTGG - Intergenic
1025314056 7:57995045-57995067 CTTTATGTACTATCCGGAAGTGG + Intergenic
1025315330 7:58017530-58017552 CTTTTTGTATGATCTGCAAGTGG + Intergenic
1026902860 7:74046609-74046631 CCTTCTGTCTGAGCAGAAAGTGG + Intronic
1026954813 7:74370507-74370529 CTAGATGTGTGAGCAGGAAAGGG - Intronic
1028101280 7:86823915-86823937 CCTTATGTATGAGCAGTGAATGG + Intronic
1029076356 7:97937561-97937583 CTTTCTGCATGTCCAGGAAGAGG - Intergenic
1031125623 7:117770731-117770753 CTTTATGGAGGAGCAGGAGGAGG + Intronic
1031425199 7:121596786-121596808 CTTTCTGTTTGTGCAGGAAGTGG + Intergenic
1033938096 7:146614497-146614519 CTTTGGTTATGAGCATGAAGCGG + Intronic
1033958605 7:146883878-146883900 TTTTATATATTAGCAGAAAGTGG - Intronic
1034885805 7:154798021-154798043 CTTTGTGTTTGAACAGGAGGAGG + Intronic
1036209100 8:6827708-6827730 CTTTCTGGAAGAGCAAGAAGAGG - Intronic
1036241394 8:7084199-7084221 CTTTCTGCATGTCCAGGAAGAGG + Intergenic
1036260680 8:7237355-7237377 CTTTCTGCATGTCCAGGAAGAGG - Intergenic
1036305930 8:7602167-7602189 CTTTCTGCATGTCCAGGAAGAGG + Intergenic
1036312718 8:7695911-7695933 CTTTCTGCATGTCCAGGAAGAGG - Intergenic
1036356778 8:8050152-8050174 CTTTCTGCATGTCCAGGAAGAGG + Intergenic
1036542549 8:9731527-9731549 CTGTATCTCTGAGCAGGAGGTGG - Intronic
1037003769 8:13751473-13751495 CAATATGTATCAGCAGGAATTGG + Intergenic
1037268898 8:17103240-17103262 CTTTATGAAAGATTAGGAAGAGG + Intronic
1037743177 8:21623262-21623284 CTTTATTTATGGGCAAGAGGGGG + Intergenic
1038621492 8:29147504-29147526 GCTTATGTATGAGCACGAATTGG - Exonic
1039286504 8:36047382-36047404 CATTATAAGTGAGCAGGAAGGGG - Intergenic
1040272761 8:45973966-45973988 CTTTATGTAGGATCTGCAAGTGG + Intergenic
1041378302 8:57224495-57224517 CTTTATAGATGAGCTTGAAGTGG + Intergenic
1041513298 8:58674278-58674300 CTTTATGGATGAGCAGCATGAGG - Intergenic
1045032918 8:98154526-98154548 CCTAAGGTATGAGCAGGGAGTGG + Intronic
1046389139 8:113545272-113545294 TTTTAAGTATGAGCATTAAGAGG - Intergenic
1046962958 8:120128928-120128950 CTTTATCTAGGAGCAGTCAGAGG + Intronic
1049374374 8:142281986-142282008 CTGTATGTGGGGGCAGGAAGTGG - Intronic
1050463917 9:5900755-5900777 CTTTTTGTAGCAACAGGAAGTGG + Intronic
1050587453 9:7127479-7127501 CTTTATTAAAAAGCAGGAAGAGG + Intergenic
1051439558 9:17069723-17069745 CATTATTAATGAGCTGGAAGAGG + Intergenic
1052835971 9:33250361-33250383 CTTTTTGTAGGAGGAGAAAGTGG + Intronic
1053687211 9:40545239-40545261 CTTTTTATAGGAGCAGCAAGTGG + Intergenic
1053712586 9:40835118-40835140 CTTTATGTAGAAGCTGCAAGTGG + Intergenic
1053714195 9:40867171-40867193 CTTTTTGTAGGATCAGCAAGTGG + Intergenic
1053936164 9:43154743-43154765 CTTTCTGTATGATCTGCAAGTGG + Intergenic
1053936267 9:43156671-43156693 CTTTTTATAGGAGCAGCAAGTGG + Intergenic
1053937354 9:43175820-43175842 CTTTATGTATAATCTGCAAGTGG + Intergenic
1054421682 9:64939931-64939953 CTTTTTATAGGAGCAGCAAGTGG + Intergenic
1054423119 9:64968365-64968387 CTTTATGTAGAAGCTGCAAGTGG + Intergenic
1054424584 9:64997520-64997542 CTTTTTGTAGGATCAGCAAGTGG + Intergenic
1054426347 9:65074245-65074267 CTTTTTGTAGTATCAGGAAGTGG + Intergenic
1055218294 9:73895228-73895250 CTGTATGAGTGACCAGGAAGGGG - Intergenic
1056482800 9:87022830-87022852 CTGAATGTATGAGCAGCAAAGGG - Intergenic
1056711887 9:88998146-88998168 CTTTATCTGTGAACAGGAACTGG - Exonic
1057767595 9:97935664-97935686 CTGTATGTAAATGCAGGAAGGGG - Intronic
1058494014 9:105534810-105534832 CTTTATATATAAGCCGGGAGGGG + Intronic
1058789340 9:108426099-108426121 CTGGATGTAGGAGCAGGAAAAGG + Intergenic
1059450871 9:114370776-114370798 CTTTATGAATGGGGAGGGAGGGG + Intronic
1203417894 Un_KI270362v1:1915-1937 CTTTATGTAGGATCTGCAAGTGG - Intergenic
1203354938 Un_KI270442v1:127250-127272 CTTTTTGTAGGATCTGGAAGTGG - Intergenic
1203420794 Un_KI270448v1:1312-1334 CTTTTTGTATTACCTGGAAGTGG + Intergenic
1203396977 Un_KI270519v1:29730-29752 CTTTATGTAAAATCAGCAAGTGG - Intergenic
1187381668 X:18807486-18807508 ATTTTTGTAAGAGCAAGAAGAGG - Intronic
1187747246 X:22422881-22422903 CTGGATGTATGCTCAGGAAGGGG - Intergenic
1188399681 X:29729408-29729430 CTTTATGTATTTGAAGGAATGGG + Intronic
1191410884 X:60401787-60401809 CTTTATGTAGAATCTGGAAGTGG + Intergenic
1191419359 X:60514914-60514936 CTTTATGTAGAATCTGGAAGTGG + Intergenic
1191443038 X:60832107-60832129 CTTTATGTAGAATCTGGAAGTGG + Intergenic
1191496568 X:61548697-61548719 CTTTATGTAGAATCTGGAAGTGG + Intergenic
1191526098 X:61943826-61943848 CTTTATGTAGAATCTGGAAGTGG + Intergenic
1191567908 X:62563317-62563339 CTTTTTGTAGGATCTGGAAGTGG + Intergenic
1191572144 X:62641213-62641235 CTTTCTGTAGGATCTGGAAGGGG + Intergenic
1192133139 X:68571692-68571714 CTCTGTGTGTGAGCAGGGAGGGG + Intergenic
1195766226 X:108298815-108298837 TTTTATGAAGGAGGAGGAAGAGG + Intronic
1197644984 X:129007568-129007590 ATTTATGAAGGAGTAGGAAGGGG + Intergenic
1198527257 X:137514011-137514033 CTTAAAGAATGAGTAGGAAGGGG + Intergenic