ID: 916301288

View in Genome Browser
Species Human (GRCh38)
Location 1:163277206-163277228
Sequence AGCAGGAGGTTCCAGGTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 740
Summary {0: 1, 1: 2, 2: 58, 3: 169, 4: 510}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916301288 Original CRISPR AGCAGGAGGTTCCAGGTCAT AGG (reversed) Intronic
902709676 1:18230224-18230246 GGCAGGAGGATCCATGTCCTGGG + Intronic
902798008 1:18811829-18811851 AGCAGGAGGTCACATGTGATTGG - Intergenic
902812883 1:18899111-18899133 AGCAGGACATTCCAGGCCAAAGG + Intronic
903071649 1:20729763-20729785 AGCCTGAGGTTAAAGGTCATGGG - Intronic
903396420 1:23005038-23005060 GGAGGGAGCTTCCAGGTCATAGG - Intergenic
903596026 1:24495449-24495471 GGAAGGGGCTTCCAGGTCATAGG + Intergenic
903618786 1:24682574-24682596 AAGAGGAGGTTCCAGGTGATAGG - Intergenic
907026557 1:51125824-51125846 AAGAGGAGGTGCCAGGTCATTGG + Intronic
907278366 1:53329051-53329073 AGAATGAGATTCCAGGGCATTGG + Intergenic
907421279 1:54348974-54348996 AGCAGCAGCTTGCTGGTCATCGG - Intronic
907971243 1:59383780-59383802 AGCAGGGGCTTCCAGATCGTAGG - Intronic
908326863 1:63031591-63031613 CGCAGGGGCTTCCAGGTCATAGG + Intergenic
908462419 1:64358085-64358107 AGCAGGGTGTTGCATGTCATAGG - Intergenic
908748630 1:67398933-67398955 AGTGGGGGCTTCCAGGTCATAGG + Intergenic
909199841 1:72677184-72677206 GGCAGGGCGTTCCAGGTCATAGG + Intergenic
909443229 1:75720873-75720895 GGGGGGAGGTTCCAGGTTATAGG + Intergenic
911022308 1:93401076-93401098 AGCAGGGGCTTCCAGGTCATAGG - Intergenic
911347558 1:96715500-96715522 AGCAGGGGCTTCCAGGTCATAGG + Intergenic
911516454 1:98873861-98873883 AGTGGGGGCTTCCAGGTCATGGG - Intergenic
911740160 1:101378236-101378258 GGTAGGGGATTCCAGGTCATAGG + Intergenic
911944888 1:104094513-104094535 AGCAGGGACTTCCAGGTCATAGG + Intergenic
912346442 1:108967492-108967514 AGCAGGGGCTTCCAGGCTATAGG + Intergenic
912388973 1:109288540-109288562 TGGAGGGGCTTCCAGGTCATAGG - Intergenic
912433967 1:109645386-109645408 AGAAGGATGTTCCAGGGCACAGG + Intergenic
912905264 1:113699115-113699137 AGCAGCAGGTTCCTGGGCACAGG + Intronic
913023503 1:114810742-114810764 AGCAGGGGCTTCCAGGTCACGGG - Intergenic
914886948 1:151593282-151593304 TGGGGGAGCTTCCAGGTCATAGG + Intergenic
915632312 1:157161951-157161973 AGCGGGGGCTTCCAGGTCATAGG + Intergenic
915672453 1:157501746-157501768 AGCAGGGGCTTCCAGGCTATAGG + Intergenic
915902413 1:159856146-159856168 ACCAGGAGGTGCCAGGTCAGGGG + Intronic
916301288 1:163277206-163277228 AGCAGGAGGTTCCAGGTCATAGG - Intronic
916543279 1:165778020-165778042 AACTGGGGCTTCCAGGTCATAGG + Intronic
917210168 1:172623075-172623097 AGCAGGAGCTTCCAGGCCACAGG + Intergenic
917312593 1:173692361-173692383 GGAGGGAGCTTCCAGGTCATAGG + Intergenic
917409960 1:174749261-174749283 AGATGGGGCTTCCAGGTCATAGG + Intronic
917638108 1:176956554-176956576 AGCAGGAGCTTCCAGCTCTGGGG - Intronic
918161051 1:181900118-181900140 AGCGGGGGCTTCCAGGTCATAGG - Intergenic
918710451 1:187721291-187721313 AGCAGAAGGTTCTAAGTCATTGG + Intergenic
918853597 1:189722556-189722578 AGCAGGGGCTTCCAGGCTATAGG - Intergenic
918870690 1:189970048-189970070 GGAAGGGGCTTCCAGGTCATAGG - Intergenic
918974891 1:191471141-191471163 AGCAGGAGCTTCTAGGTCATAGG - Intergenic
919145647 1:193631115-193631137 ATAAGGAGCTGCCAGGTCATAGG - Intergenic
919190718 1:194214636-194214658 AGAAGGGGCTTCCAGGCCATAGG + Intergenic
919424310 1:197410524-197410546 AGCATGTGGTTCCAGGTCATAGG - Intronic
920010666 1:202865154-202865176 AGTGGGGGCTTCCAGGTCATAGG + Intergenic
920023865 1:202977608-202977630 AGCAGGGGCTTCCAAGTCATAGG + Intergenic
920353340 1:205352277-205352299 GGAAGGAGGTGCCAGGTCACTGG + Intronic
921776121 1:219102209-219102231 AACAGGGACTTCCAGGTCATAGG - Intergenic
921776464 1:219105972-219105994 AACAGGGACTTCCAGGTCATAGG + Intergenic
922076023 1:222245467-222245489 AGCAGGGGCTTCCAGGTCATAGG + Intergenic
923066368 1:230520969-230520991 AGCAGGGGCTTCCAGATCATAGG + Intergenic
923252420 1:232189912-232189934 AGCAGGGGATTGCAGGTCATAGG + Intergenic
923384562 1:233453681-233453703 AGCAGAGGCTTTCAGGTCATAGG - Intergenic
923666163 1:236000452-236000474 AGGGAGAGCTTCCAGGTCATAGG - Intronic
923769858 1:236929043-236929065 AGCAGAGACTTCCAGGTCATAGG - Intergenic
923790947 1:237110751-237110773 AGCAGGAGGTTTCAGAGCATTGG - Intronic
924259936 1:242219414-242219436 GACAGGAGGTTCCTAGTCATTGG - Intronic
924272585 1:242349135-242349157 AGTGGGGGCTTCCAGGTCATAGG + Intronic
924644216 1:245862057-245862079 AGCAGGAGGTCCCTGCTCATGGG - Intronic
924769535 1:247066925-247066947 AGTGGGGGCTTCCAGGTCATAGG - Intronic
924920185 1:248620809-248620831 AGCAGGAGTTTCTAAGTCAGAGG - Intergenic
1062825034 10:561015-561037 AGCAGGGGTGTCCAGGTCATAGG - Intronic
1062860521 10:806106-806128 AGCAGGAGGATCCAGGCCGGAGG + Intergenic
1062962738 10:1585626-1585648 AGCAGGGGCTTCCAGGTCATAGG - Intronic
1063020157 10:2119032-2119054 AGAGGGGGCTTCCAGGTCATAGG - Intergenic
1063107028 10:3001222-3001244 AGCGGGAACTTCCAGCTCATAGG + Intergenic
1064138098 10:12767674-12767696 AGCAGAGGCTTCCAGGTCTTAGG + Intronic
1064160845 10:12944442-12944464 AGCAGGGGCTTCCAGGTCAGAGG - Intronic
1064302671 10:14136638-14136660 GGGGGTAGGTTCCAGGTCATAGG - Intronic
1064520263 10:16193537-16193559 AGCGGAGGGTTCCAGGTCATAGG - Intergenic
1064804766 10:19118435-19118457 AGAGGGGGCTTCCAGGTCATAGG + Intronic
1065209877 10:23392703-23392725 GGGAGGGGGCTCCAGGTCATAGG + Intergenic
1065365686 10:24934657-24934679 AGCGGCAGCTTCCAGATCATGGG - Intronic
1065858090 10:29846931-29846953 GGAGGGAGCTTCCAGGTCATAGG + Intergenic
1066040268 10:31542333-31542355 AGCAAGGGCTTCCAGGTCATAGG - Intergenic
1066062806 10:31739048-31739070 AGCGAGGGCTTCCAGGTCATAGG + Intergenic
1066712082 10:38247008-38247030 AGTGGGGGCTTCCAGGTCATAGG - Intergenic
1067409726 10:46053817-46053839 AGCAGGGGCTTACAGGTCATAGG - Intergenic
1068047506 10:51906504-51906526 AGTGGGAGCTTCTAGGTCATAGG + Intronic
1068365045 10:56037148-56037170 AGTAGGGGCTTCCAGGTCATAGG + Intergenic
1068366121 10:56052244-56052266 AGCAGGGGCTTCCAGGCTATAGG - Intergenic
1068438471 10:57020322-57020344 AGCAGGGACTTCCAGGTAATAGG + Intergenic
1068603007 10:58975242-58975264 AGCAGGGGCTTCCACGTCATAGG - Intergenic
1068685664 10:59867888-59867910 AGTGGGGGCTTCCAGGTCATAGG - Intronic
1069261412 10:66403049-66403071 AGCAGGGGCTTACAGGTCATAGG - Intronic
1069329785 10:67278441-67278463 AGCAGGGGCTTCCAGGCCATAGG + Intronic
1069423974 10:68273364-68273386 AACAGGGGCTTCCAGGTCATAGG - Intergenic
1069624500 10:69859565-69859587 AGGAAGAAGTCCCAGGTCATAGG + Intronic
1070022869 10:72603889-72603911 AGCAGGGGCTTCCAGGTTATAGG + Intronic
1070042139 10:72792323-72792345 AGCAGGGGCTTACAGATCATAGG + Intronic
1070251125 10:74773885-74773907 AGAGGGGGCTTCCAGGTCATAGG + Intergenic
1070713564 10:78701056-78701078 TGCAGGAGGTCCCAGGACCTTGG - Intergenic
1070724974 10:78781583-78781605 GGCCTGAGGTTCCAGGTCTTGGG + Intergenic
1070905410 10:80068111-80068133 AGCAGGGGCTTCCAGGTTATAGG - Intergenic
1071287562 10:84162990-84163012 GGGTGGTGGTTCCAGGTCATAGG - Intergenic
1071676681 10:87661273-87661295 AGCAGGAGGGTCCAGGGTGTAGG + Intronic
1071829095 10:89354242-89354264 AGTGGGAGCTTCCAGGTGATAGG - Intronic
1072015395 10:91341819-91341841 AGCAGGAGCTTACAGGTCATAGG - Intergenic
1072264619 10:93715177-93715199 AGCAAGAGCTTACAGGTCATAGG - Intergenic
1072809396 10:98447159-98447181 AGCCTGAGGTTCCGGGGCATGGG - Intergenic
1073076573 10:100828386-100828408 AGCAGGAGGTGCCGGGCCCTGGG - Exonic
1073396022 10:103218223-103218245 GGTGGGGGGTTCCAGGTCATAGG + Intergenic
1073396109 10:103218974-103218996 AGCAAGGGCTTCCAGGTCATAGG + Intergenic
1073483789 10:103803947-103803969 ACGAGGGGCTTCCAGGTCATAGG + Intronic
1074185848 10:111098886-111098908 AGCAGGAGGCTCTGGGTCCTTGG - Intergenic
1074228018 10:111506336-111506358 AGCAGGGGCTCCCAGGTCATAGG + Intergenic
1075234896 10:120718784-120718806 GGGGGGAGGTTACAGGTCATAGG - Intergenic
1075977567 10:126708872-126708894 AGAGGGGGCTTCCAGGTCATAGG - Intergenic
1076551429 10:131280436-131280458 AGGAGGGGCTTCCAGGTCAAAGG + Intronic
1077285844 11:1765414-1765436 AGGGGCAGCTTCCAGGTCATAGG - Intergenic
1077534057 11:3110761-3110783 GGGAGGGGCTTCCAGGTCATAGG - Intronic
1077559163 11:3246539-3246561 AGAAGAGGCTTCCAGGTCATAGG + Intergenic
1077738229 11:4815059-4815081 AGCAGGAGCTTCCAGGTAATAGG + Intronic
1079643472 11:22834690-22834712 AGCAGGAGCTTCCAGGCTATAGG - Intergenic
1080406672 11:31986294-31986316 AGCTGGAGATTCCAGGCCATTGG - Intronic
1080437992 11:32263902-32263924 AGCAGGGGCTTACAGGTCATAGG - Intergenic
1081274674 11:41133874-41133896 AGCAGGGGCTTACAGGTTATAGG - Intronic
1082278476 11:50246285-50246307 AGCAGGGGGTTCCTGGTTCTCGG + Intergenic
1083705209 11:64509400-64509422 AGCAGAGGCTTACAGGTCATAGG + Intergenic
1084217937 11:67661164-67661186 AGCAGGGGCTTCCAGGCTATAGG - Intergenic
1084248855 11:67880276-67880298 GGAAGGGGCTTCCAGGTCATAGG - Intergenic
1084575359 11:69985390-69985412 AGCTGGAGGTTACAGGTCACTGG - Intergenic
1084614888 11:70229211-70229233 GGCAGGGGCTTCCAGGTCATAGG - Intergenic
1084823963 11:71715200-71715222 GGAAGGGGCTTCCAGGTCATAGG + Intergenic
1085796183 11:79542135-79542157 AGCAGGGGCTTCCAAGTCATAGG - Intergenic
1086003862 11:82012974-82012996 AGCAGGGGCTTCCAGGTCATAGG + Intergenic
1086127570 11:83365018-83365040 AGCCAGGGCTTCCAGGTCATAGG + Intergenic
1086127981 11:83369335-83369357 GGAGGGAGCTTCCAGGTCATAGG + Intergenic
1087050189 11:93879005-93879027 GGGAGGGGCTTCCAGGTCATAGG + Intergenic
1087132008 11:94676743-94676765 AGCAGGGGCTTATAGGTCATAGG + Intergenic
1087389098 11:97512121-97512143 AGCAGGGGCTTCCAGGCTATAGG + Intergenic
1087471991 11:98587276-98587298 AGTAGGGGCTTACAGGTCATAGG + Intergenic
1087900191 11:103631771-103631793 AGCAGGAGCTTCCAGGTCTTAGG - Intergenic
1087991130 11:104746098-104746120 AGCAGGGGCTTCCAAGTCATGGG - Intergenic
1089140152 11:116278043-116278065 AGCCAGAGTTTCCAGGGCATGGG - Intergenic
1089395273 11:118132520-118132542 AGCAGGAGGTCCCAGGCAACAGG + Intergenic
1089864140 11:121616973-121616995 AGCAGGGGTTTCCAGGCTATAGG + Intronic
1090099711 11:123781403-123781425 AGCAGGGGCTTCCAGGTTATAGG - Intergenic
1091691837 12:2602321-2602343 AGAAGGAGGGTCCAGGTCAGGGG - Intronic
1092304134 12:7282206-7282228 AGCAGGGGTTTCCAGGTCATAGG - Intergenic
1092336145 12:7635756-7635778 AGCAGGGGCTTCCAGGCTATAGG + Intergenic
1092645746 12:10570156-10570178 AGCAGGGGCTTGCAGGTCATAGG - Intergenic
1092725993 12:11486048-11486070 AAGAGGAGCTTCCGGGTCATAGG - Intronic
1093130291 12:15383706-15383728 AGCAAGAGCTTCCAGGTCATAGG + Intronic
1093623722 12:21322474-21322496 AGCAGGGGGTTCCCAGTCATAGG + Intronic
1093624785 12:21332258-21332280 AGCAGGAACTTGCAGGTCACAGG + Intronic
1094037298 12:26084847-26084869 GGAGGGAGCTTCCAGGTCATAGG - Intergenic
1094079047 12:26512550-26512572 AGCAGGGGCTTCCAGGTTATAGG - Intronic
1095541363 12:43312046-43312068 GGGAGGGGCTTCCAGGTCATAGG - Intergenic
1097252095 12:57640878-57640900 GGAGGGAGCTTCCAGGTCATAGG - Intergenic
1097255096 12:57667452-57667474 GGAAGGGGCTTCCAGGTCATAGG - Intergenic
1097733484 12:63154930-63154952 AGCGGGAGGTTTCAGGTCATAGG - Intergenic
1097931371 12:65190554-65190576 AGCAGGGGCTTCCAGGTCATAGG - Intronic
1098698064 12:73584496-73584518 AGCAGGGGCTTACAGGTCATAGG - Intergenic
1098710406 12:73751277-73751299 AGCAGGGGCTTACAGGTCATGGG + Intergenic
1099050993 12:77781491-77781513 GTGGGGAGGTTCCAGGTCATAGG - Intergenic
1099798909 12:87432496-87432518 AGCAGGGGCTTCCAGGCTATAGG + Intergenic
1100079846 12:90835351-90835373 GGGAGGGGCTTCCAGGTCATAGG - Intergenic
1100121417 12:91373362-91373384 GGGAGGGGCTTCCAGGTCATAGG - Intergenic
1100710610 12:97252336-97252358 AGAGGGGGCTTCCAGGTCATAGG - Intergenic
1102251454 12:111390126-111390148 GGCAGGACCTTCCAGGTCTTTGG - Intergenic
1102444250 12:112989478-112989500 AGTGGGGGCTTCCAGGTCATTGG + Intronic
1102578202 12:113870523-113870545 AGTAGGAGGATCCAGGTCTTTGG - Intronic
1103211706 12:119171848-119171870 GGCAAGGGCTTCCAGGTCATAGG + Intergenic
1103246415 12:119461747-119461769 AGCAGGAGGCCCCAGGTGAGTGG + Intronic
1103727082 12:123003325-123003347 AGCAGGAAGTGCCAGGACAGCGG - Intronic
1104229818 12:126873980-126874002 AGTGGAAGCTTCCAGGTCATAGG - Intergenic
1104321606 12:127756721-127756743 GGAAGGGGCTTCCAGGTCATAGG - Intergenic
1104473890 12:129054380-129054402 AGCAGGAGCTTTGGGGTCATAGG - Intergenic
1104530604 12:129566927-129566949 AGCAGGAGTTTCCAAGTCATAGG - Intronic
1104561150 12:129845966-129845988 AGTAGTAACTTCCAGGTCATTGG + Intronic
1104745674 12:131208699-131208721 GGCATGAGGGTGCAGGTCATCGG + Intergenic
1105038550 12:132943952-132943974 ATCAGGACGTTCCTGGGCATGGG - Intronic
1105748350 13:23398592-23398614 AGCAGGGGCTTCCAGGCTATAGG + Intronic
1106123022 13:26877609-26877631 AGAAGGGGCTTCCAGGCCATAGG + Intergenic
1106434453 13:29711456-29711478 AGCAGGGGCTTACAGGTCACAGG + Intergenic
1106850524 13:33785574-33785596 AGCAGGAGGTTACAGCTGATAGG - Intergenic
1107021333 13:35755534-35755556 AGCAGGAGCTTCCAGTTCACAGG + Intergenic
1107117322 13:36761218-36761240 AGTGGGGGCTTCCAGGTCATAGG + Intergenic
1107155947 13:37167049-37167071 AGTGGGGGCTTCCAGGTCATAGG - Intergenic
1107362910 13:39639259-39639281 AGCAGGGGCTTCCAGGCTATAGG - Intergenic
1107530001 13:41273926-41273948 GGAAGGAGCTTTCAGGTCATAGG + Intergenic
1108100266 13:46946833-46946855 AGCAGGGGCTTCTAGGTCATAGG - Intergenic
1108613723 13:52109789-52109811 GGAGGGAGCTTCCAGGTCATAGG - Intronic
1109960454 13:69622045-69622067 GGCAGGGGCTTCCAGGTCATAGG - Intergenic
1110085189 13:71369495-71369517 AGCAGGGGCTTCCAGGTCATAGG + Intergenic
1110167446 13:72460405-72460427 GACAGGATGTGCCAGGTCATTGG - Intergenic
1110605450 13:77426940-77426962 AGCAGAGATTTCCAGGTCATAGG - Intergenic
1110666416 13:78122606-78122628 GGCAGGGGCTTCCAGGTCATAGG + Intergenic
1110707094 13:78608622-78608644 AGAAGGGGCTTCCAGGTCCTGGG + Intergenic
1110869664 13:80435547-80435569 AGCAGGTGCTTCCAGGTTATAGG - Intergenic
1111044731 13:82799569-82799591 AGTGGGGGCTTCCAGGTCATAGG + Intergenic
1111472717 13:88706024-88706046 AGCGGGGGCTTCCAGGTTATTGG + Intergenic
1111563163 13:89979042-89979064 AGCAGGAGCTTCCAAATCATAGG - Intergenic
1111654943 13:91140601-91140623 AGAGGGGGCTTCCAGGTCATAGG - Intergenic
1112281358 13:98065533-98065555 AGGTGGGGCTTCCAGGTCATAGG + Intergenic
1113091332 13:106619769-106619791 ATCAGTAGGTTACAGGTCAAAGG + Intergenic
1113099061 13:106697538-106697560 AGAAGTAGGATCCATGTCATTGG - Intergenic
1113535665 13:111064482-111064504 AGCAGGGGCTTCCAGGTCACAGG - Intergenic
1113727637 13:112617070-112617092 AGCAGGGATTTCCAGGTCCTAGG - Intergenic
1113931975 13:113973513-113973535 AGGAGGGGCTTCCAGGTCGTAGG - Intergenic
1114080116 14:19196498-19196520 AGTGGGGGCTTCCAGGTCATAGG - Intergenic
1114229194 14:20765366-20765388 AGCAGGGGCTCACAGGTCATAGG - Intergenic
1114707538 14:24742544-24742566 TGCAAGAGCTTCCAGATCATAGG - Intergenic
1116054753 14:39849425-39849447 AGTGGGGGCTTCCAGGTCATAGG - Intergenic
1116851976 14:49917820-49917842 AGTAGGAAATTCCAGGTAATGGG + Intergenic
1116987626 14:51238437-51238459 GGAAGGGGCTTCCAGGTCATAGG + Intergenic
1117371401 14:55081648-55081670 AGGAGGAGGTTCTGGGTCAATGG - Intergenic
1118264231 14:64279136-64279158 AGCAGGGGCTTCCAAGTCACAGG - Intronic
1118395067 14:65329214-65329236 AGCAGGGGCTTCTAGGTCATAGG + Intergenic
1118627486 14:67672908-67672930 AGCAGGAAGTTCCATGTGTTTGG - Intronic
1119147193 14:72328091-72328113 AGCTGGATGTCCCAGGTCAAGGG + Intronic
1119796285 14:77400571-77400593 GGCGGGGGTTTCCAGGTCATAGG + Intronic
1119833852 14:77729137-77729159 AGATGGAGGTGCCAGGTAATTGG - Intronic
1120107536 14:80514140-80514162 AGCAGGGGCTTCCAGGCTATAGG - Intronic
1120402039 14:84044204-84044226 AGTGGGGGCTTCCAGGTCATAGG - Intergenic
1120966672 14:90173786-90173808 AGCAGGGGCTTACAGATCATAGG + Intronic
1120974794 14:90239103-90239125 AGCAGGGGCTTCCAGGCTATAGG - Intergenic
1121108525 14:91296409-91296431 TCCAGGAGGTTTCAGGTCAGGGG - Intronic
1121697615 14:95926514-95926536 ACCAGGAGGTTTCTGGCCATAGG - Intergenic
1121787160 14:96670675-96670697 AGCAGGACTTTCCAGGGCCTGGG - Intergenic
1122186361 14:100000292-100000314 GGATGGAGCTTCCAGGTCATAGG + Intronic
1124033150 15:26029649-26029671 AGCAGGGGCTTCCAGGCTATAGG + Intergenic
1124179645 15:27460623-27460645 AGCAGAAGCTTACAGGTCAGAGG + Intronic
1125043754 15:35222537-35222559 AGGGGGGGGTTTCAGGTCATCGG + Intronic
1125281632 15:38047888-38047910 ATCAGGAGGGCCCAGGGCATAGG - Intergenic
1126266934 15:46766031-46766053 AGCAGGGGCTTCCAGGCTATAGG + Intergenic
1126707159 15:51416247-51416269 AGGAGGGGCTTCCAGGTCACAGG + Intergenic
1127284117 15:57517725-57517747 AGGAGTAGGTTCCTGGTCAATGG - Intronic
1128603556 15:69017525-69017547 AGCAGGGGCTTCCGGGTCGTAGG - Intronic
1129205618 15:74035578-74035600 GGCAGGATGTTCCTGGGCATTGG - Intronic
1129519193 15:76175456-76175478 AGCAGCAGGTTCGAGGCCCTGGG - Intronic
1129927035 15:79373825-79373847 AGCAGGGGCTTACAGGTCATAGG + Intronic
1130695147 15:86123642-86123664 AGCAGGGGCTTCCAGGTCATAGG - Intergenic
1130732739 15:86516004-86516026 GGAGGGAGCTTCCAGGTCATAGG + Intronic
1130889754 15:88123722-88123744 AGCAGGGGCTTCCAAGTCATAGG + Intronic
1131012019 15:89026044-89026066 ATCTGCAGGTTCCATGTCATTGG - Intergenic
1131511127 15:93050108-93050130 AGCAGGATGTTGAAGGCCATTGG - Intronic
1132199741 15:99943291-99943313 AGCGTGGGGTTCCAGGTCACAGG + Intergenic
1132337391 15:101057069-101057091 GGCAGGAGGTCCCAGGCCCTGGG - Intronic
1132417882 15:101637124-101637146 AGCAGGGGCTTCCAGATCATGGG + Intronic
1133358655 16:5156162-5156184 GGGAGGGGCTTCCAGGTCATAGG - Intergenic
1133576845 16:7099730-7099752 GGAAGGTGTTTCCAGGTCATAGG + Intronic
1133652242 16:7823194-7823216 GGAAGGGGTTTCCAGGTCATAGG + Intergenic
1134338635 16:13324893-13324915 AGCGGGGGCTTCCAGGCCATAGG + Intergenic
1134592611 16:15467884-15467906 AGCAGGAACTTTCAAGTCATAGG + Intronic
1134872721 16:17666476-17666498 AGCAGGAGGTACCTAGTGATTGG + Intergenic
1135988012 16:27198411-27198433 GGAAGGGGCTTCCAGGTCATAGG - Intergenic
1136491169 16:30609568-30609590 AGCAGCCGGTTCCCAGTCATCGG + Exonic
1137061708 16:35796333-35796355 AGCAGGGGCTTCCAGCTTATAGG - Intergenic
1137065806 16:35841954-35841976 AGTAGGAGATTTGAGGTCATGGG - Intergenic
1137657128 16:50169928-50169950 AGCAGAAGTTCACAGGTCATAGG - Intronic
1138564507 16:57823271-57823293 AGCAGGGGCTTCCAGGTCATAGG - Intronic
1138576491 16:57910722-57910744 AGGAGTGGCTTCCAGGTCATAGG - Intronic
1139117820 16:63978566-63978588 AGAAGGGGCTTACAGGTCATAGG - Intergenic
1140458482 16:75118525-75118547 GGGAGGAGCTTACAGGTCATAGG - Intergenic
1140530786 16:75664092-75664114 AGCAGGGGCTTCCAAGTCATAGG - Intronic
1141241146 16:82266369-82266391 AGGAGAGGGTTCCAGGTTATAGG + Intergenic
1143374473 17:6459105-6459127 AGCTGGAGGATCCAAGTTATAGG - Intronic
1143420516 17:6787980-6788002 AGCAGGGGCTTCCAGGGTATAGG + Intronic
1143437875 17:6942674-6942696 GGCAGCAGCTTCCAGGTCATAGG - Intronic
1143887932 17:10079596-10079618 AGCTGGGGTTTCCAGGTTATAGG - Intronic
1144189762 17:12833777-12833799 AGCAGGCGCTTCCACGCCATAGG + Intronic
1144888587 17:18480290-18480312 AGCAGGAGGATCAAAGTCAGAGG - Intronic
1145021850 17:19438137-19438159 AGAGGGGGCTTCCAGGTCATAGG - Intergenic
1145125613 17:20297746-20297768 TGTAGGAGGTTCTAGGTCAGGGG - Intronic
1145143619 17:20464008-20464030 AGCAGGAGGATCAAAGTCAGAGG + Intronic
1145822325 17:27848549-27848571 ACCAGGGGCTTACAGGTCATAGG - Intronic
1145887144 17:28390159-28390181 AGCAGGGGCTTCCAGGCTATAGG + Intronic
1146103198 17:30005976-30005998 AGCAGGGGTTTGCAGGTTATAGG - Intronic
1146441404 17:32898343-32898365 GGGAGGGGCTTCCAGGTCATAGG + Intergenic
1147513610 17:41095515-41095537 GGGAGGGGCTTCCAGGTCATAGG - Intronic
1147515714 17:41115805-41115827 GGGAGGGGCTTCCAGGTCATAGG - Intergenic
1147682421 17:42259345-42259367 AGCAGGAGCTTCAAGGACATGGG + Intronic
1148949564 17:51298668-51298690 AGTAATAGGTTCCAGGTCAGTGG + Intergenic
1149569840 17:57664571-57664593 GCCAAGAGGTTCCAGGTGATAGG + Intronic
1150555844 17:66253380-66253402 AGGGGGTGCTTCCAGGTCATAGG + Intronic
1150956548 17:69866523-69866545 AGGAGGGGCTTCCAGGTCATAGG - Intergenic
1151346488 17:73505916-73505938 AGAAGCAGGTTCCAGCTCAGTGG - Intronic
1153157155 18:2162689-2162711 AGCAGGGGCTTCCAGGCTATAGG - Intergenic
1153182084 18:2446272-2446294 AGTGGGGGCTTCCAGGTCATAGG + Intergenic
1153535131 18:6094190-6094212 TGCAGAAGGAACCAGGTCATTGG - Intronic
1153796716 18:8630289-8630311 GGCTGGGGCTTCCAGGTCATAGG + Intronic
1154407969 18:14113373-14113395 GGAGGGAGTTTCCAGGTCATGGG - Intronic
1155173521 18:23284473-23284495 AGCAGGGACTTACAGGTCATAGG - Intronic
1155429366 18:25739509-25739531 AACAGGAGGTTCCAATTCATTGG + Intergenic
1155514035 18:26606046-26606068 AGCAGGAGATTTCAGGTCATAGG + Intronic
1155850589 18:30769308-30769330 AGCAGGGGCTTCCAGGTCATAGG - Intergenic
1157721123 18:49925302-49925324 GGCGGGAGCTTCCAGGTCACAGG - Intronic
1157904500 18:51557254-51557276 AGCAGAAGGTTAAAGGTCATGGG + Intergenic
1157954740 18:52084382-52084404 AGCAGGGGCTTCCCGGTCATAGG - Intergenic
1158166727 18:54548593-54548615 AGCAGGGGCTTCCAGGTCACAGG + Intergenic
1158167342 18:54555293-54555315 AGCAGGGGCTTCCAGATCACAGG + Intergenic
1158189589 18:54811418-54811440 GGCAGGAGCTCCCAGGTCATAGG + Intronic
1158894166 18:61897620-61897642 AGCAGGGGCTTCCAGGCTATAGG + Intergenic
1159280061 18:66273762-66273784 AGCAGCAGTTACCAGGTTATAGG - Intergenic
1159899759 18:74035104-74035126 AGCAGGGGCTTCCAGATCATAGG - Intergenic
1160402889 18:78623770-78623792 AGGAGGGGCTTCCAGGTCATAGG + Intergenic
1161019869 19:2004086-2004108 GGGAGGGGCTTCCAGGTCATAGG - Intronic
1163533239 19:17862820-17862842 AACAGGATGTGTCAGGTCATTGG + Intronic
1164120440 19:22261127-22261149 GGCGGGAGCTGCCAGGTCATAGG - Intergenic
1164126462 19:22322817-22322839 GGCGGGAGCTTCCAGGTCATAGG + Intergenic
1164172883 19:22740944-22740966 GGTGGGAGCTTCCAGGTCATAGG - Intergenic
1164179861 19:22808631-22808653 GGCAGGAGCTTCCAGGTCATAGG + Intergenic
1164473031 19:28551660-28551682 GCCAGGGGCTTCCAGGTCATAGG - Intergenic
1164524463 19:29003220-29003242 GGGAGGAGCTTACAGGTCATAGG + Intergenic
1164698122 19:30262191-30262213 AGCAGGAGACTCCAGGTGAGAGG + Intronic
1165432862 19:35782330-35782352 AGGAGGAAGATCCAGGTCAGAGG - Intronic
1165597659 19:37024196-37024218 AGGAGGTGCCTCCAGGTCATAGG - Intronic
1165609477 19:37138200-37138222 AGTGGGGGCTTCCAGGTCATAGG - Intronic
1165854294 19:38870562-38870584 AGGACGAGGATCCAGGTAATGGG - Exonic
1167677900 19:50899766-50899788 AGCAGTAACTTCCAGGTCATTGG + Intergenic
1168008463 19:53510133-53510155 AGCAGGATGTTCCATCACATAGG - Intergenic
925437924 2:3857229-3857251 TGGAGGAGGTTCCAGGCCAAAGG - Intergenic
925943653 2:8841409-8841431 AGGGGGTGCTTCCAGGTCATAGG + Intergenic
926979958 2:18558846-18558868 AGTGGGGGCTTCCAGGTCATAGG - Intronic
927033939 2:19152048-19152070 CACAGGGGCTTCCAGGTCATAGG + Intergenic
927244904 2:20949722-20949744 AGCAGGGCTTTCCAGGGCATGGG - Intergenic
927357328 2:22188041-22188063 AGCAGTAGGTCGCAGGTCAGAGG - Intergenic
927746244 2:25624164-25624186 ACAGGGAGCTTCCAGGTCATAGG - Intronic
927947209 2:27142744-27142766 AGCAGGGGCTTTCAGGTCATAGG - Intergenic
928350479 2:30548427-30548449 AGCAGGGGCTTCCAGGCTATAGG + Intronic
928399040 2:30964850-30964872 AGTGGGAAGTTCCAGGTGATGGG - Intronic
929490824 2:42394653-42394675 GGGAGGGGCTTCCAGGTCATAGG - Intronic
929570204 2:43018165-43018187 AGCTGGAGTTTCCAGTGCATGGG + Intergenic
929915225 2:46129616-46129638 CTCAGGAGGTTCCAGGGCAGAGG - Intronic
930021245 2:47003462-47003484 AGCAAGGGGTTCCATGTCACTGG + Intronic
930285508 2:49422881-49422903 AGCAGGGGCTTCCAGGTCACAGG - Intergenic
930494691 2:52126503-52126525 GGGAGGGGCTTCCAGGTCATAGG - Intergenic
931020724 2:58041891-58041913 AGGGGGGAGTTCCAGGTCATAGG - Intronic
931042137 2:58312600-58312622 AGCAGGGGTTTTCAGGTCATAGG + Intergenic
931402723 2:61945763-61945785 AGTGGGGGCTTCCAGGTCATAGG + Intronic
931654529 2:64498975-64498997 AGTGGGGGCTTCCAGGTCATAGG + Intergenic
932058606 2:68472013-68472035 AGCAGGGGCTTCCAGGCTATAGG + Intronic
933516025 2:83303273-83303295 AGAGGGGGCTTCCAGGTCATAGG - Intergenic
933536831 2:83585842-83585864 AGCAGGGGCCTCCAGGTCATAGG - Intergenic
934108393 2:88717461-88717483 GGAGGGAGCTTCCAGGTCATAGG + Intronic
934131303 2:88951819-88951841 AGCAGGGGCTTCCAGGTCACAGG - Intergenic
934133136 2:88969079-88969101 AGCAGGGGCTTCCAGGTCACAGG - Intergenic
934140606 2:89043760-89043782 AGCAGGGGCTTCCAGGTCATAGG - Intergenic
934141224 2:89049859-89049881 AGCAGGGGTTTCCAGGTCATAGG - Intergenic
934146925 2:89104079-89104101 AGTAGGGGCTTCCAGGTCATAGG - Intergenic
934222340 2:90096516-90096538 AGTAGGGGCTTCCAGGTCATAGG + Intergenic
934228016 2:90150686-90150708 AGCAGGGGTTTCCAGGTCATAGG + Intergenic
934228630 2:90156782-90156804 AGCAGGGGCTTCCAGGTCATAGG + Intergenic
934233282 2:90206304-90206326 AGCAGGGGCTTCCAGGTCATAGG + Intergenic
935598917 2:104902149-104902171 AGGAGAAGGTTGCAGGTAATAGG - Intergenic
936860560 2:117013078-117013100 AGCAGGGGCTTCCAGGTCATAGG + Intergenic
936886164 2:117311652-117311674 AGCAGGGGCTTCCAGCTTATAGG - Intergenic
937227080 2:120376131-120376153 AGCAGGAGGGTCCTGGCCTTCGG + Intergenic
937265495 2:120612474-120612496 AGAAGGAGGTTACAGGTGTTAGG - Intergenic
937775373 2:125769639-125769661 CTGAGGAGCTTCCAGGTCATAGG + Intergenic
938259674 2:129886504-129886526 AGCAAGGGCTTCCGGGTCATAGG + Intergenic
938578161 2:132622626-132622648 AGCAGAAGCTTACAAGTCATAGG + Intronic
944736788 2:202574413-202574435 AGGTGGAGGTTGCAGGTCCTGGG - Intergenic
945114678 2:206399774-206399796 AGCAGGGGCTTCCAGGTCATAGG + Intergenic
945573761 2:211503944-211503966 TCCAGGATGTTCCAGGTTATGGG - Intronic
945811515 2:214555197-214555219 AGAAGGGTCTTCCAGGTCATAGG - Intronic
947267427 2:228299092-228299114 AGTGGGGGCTTCCAGGTCATAGG + Intergenic
947975473 2:234362197-234362219 AGAGAGAGCTTCCAGGTCATAGG - Intergenic
947996331 2:234530915-234530937 AGCAGGGGCTTCCAGGTCATTGG - Intergenic
948438335 2:237968383-237968405 AGCAGGAGGTTCCTGGGCACTGG + Intronic
1169198335 20:3695072-3695094 AGCAGGAGGGGCCAAGGCATAGG - Intronic
1169443434 20:5652107-5652129 AGCAGGGGTTTCCAGGTCTTAGG - Intergenic
1169949452 20:11027248-11027270 AAAAGGAGGTTTCAGGGCATAGG - Intergenic
1170074514 20:12404997-12405019 AGCAGGGGCTTCCAGGCCATAGG + Intergenic
1170191825 20:13652185-13652207 AGTGGGAGCTTCTAGGTCATAGG + Intergenic
1170544466 20:17423267-17423289 AGCAGGGGCTTCCAGGTTATAGG + Intronic
1170557008 20:17522891-17522913 AGCAGGAGGTTCCTAGTCACAGG + Intronic
1170564336 20:17588260-17588282 AACAGGGGATTCCAGGACATAGG - Intronic
1170715140 20:18824744-18824766 AGCAGGTGGTTCCAGGTCTCAGG - Intronic
1171235553 20:23521374-23521396 AGTGGGGGCTTCCAGGTCATAGG + Intergenic
1171945000 20:31368642-31368664 AGCAGGAGTTTCATGGTCCTTGG - Exonic
1173556116 20:43967071-43967093 AGAAGGATGTTGCAGGTGATTGG + Intronic
1173863667 20:46300373-46300395 AGCAGGTGGATCCAGGTCAGTGG - Intronic
1174558333 20:51412460-51412482 AGCAGGGAGTTCCAGTTCCTGGG + Intronic
1175586738 20:60147083-60147105 GGCAGGGGCTCCCAGGTCATAGG + Intergenic
1175757425 20:61538601-61538623 GGCAGGAGGTACCAGATCCTGGG - Intronic
1177217570 21:18150087-18150109 AGCAGGGGCTTCCAGGTTATAGG + Intronic
1177603969 21:23355168-23355190 AGCAGAAGCTTACAGGTCTTAGG + Intergenic
1178386302 21:32153399-32153421 AGCAGGGGCTTCCAGGCTATAGG + Intergenic
1179022408 21:37652173-37652195 ACCAGGAAGCTTCAGGTCATAGG + Intronic
1179592482 21:42418308-42418330 AGCAGGAGGTGGCAGGTGATAGG + Intronic
1179672228 21:42957635-42957657 AGTGGGGGCTTCCAGGTCATAGG - Intergenic
1180016331 21:45087544-45087566 AGGAGTGGGTGCCAGGTCATAGG + Intronic
1180256666 21:46634674-46634696 GGAGGGAGCTTCCAGGTCATAGG + Intergenic
1180500658 22:15926202-15926224 AGTGGGGGCTTCCAGGTCATAGG + Intergenic
1181340606 22:22176681-22176703 AGCAGGGGCTTTCAGGTCAAAGG - Intergenic
1181451379 22:23024383-23024405 TGGAGGGGCTTCCAGGTCATAGG - Intergenic
1181515314 22:23407647-23407669 GGCAGGGTCTTCCAGGTCATAGG + Intergenic
1181984032 22:26786880-26786902 AGCAGAGGCTTACAGGTCATAGG + Intergenic
1182068317 22:27445801-27445823 AGCAGGAGGTTCCAAATGACTGG - Intergenic
1182455351 22:30446926-30446948 AGCAGGGGCTTCCAGGTAATAGG + Intergenic
1182588672 22:31362315-31362337 AGGAGGGGCTTCCAGGTCATAGG + Intergenic
1182851250 22:33476393-33476415 AGGCGGAGCTTCCAGGTCATAGG - Intronic
1184335822 22:43852524-43852546 GGCAGGAGCTCCCAGGTCCTGGG - Intronic
1184576802 22:45375219-45375241 AGAGGGGGCTTCCAGGTCATAGG - Intronic
1184585310 22:45443898-45443920 AGCAGGGATTTCCAGGTCATAGG + Intergenic
1184890797 22:47377944-47377966 GGGAGGGGCTTCCAGGTCATAGG - Intergenic
1184936410 22:47726666-47726688 AGCAGGAATTACCAGATCATAGG - Intergenic
1185092403 22:48783348-48783370 GGCAGGAGGTGACAGGCCATAGG - Intronic
1185214760 22:49592225-49592247 AGTAGAAGCTTCCAGGTCATAGG - Intronic
949163882 3:913776-913798 GGGAGGGGCTTCCAGGTCATAGG - Intergenic
949243107 3:1894386-1894408 AGCAGGAGATCCAAGGTCATTGG + Intergenic
949698045 3:6721667-6721689 TGCAGGTGGTTCCTGGTTATTGG + Intergenic
949927624 3:9054463-9054485 AGCAGGGGCTTTCAGGTCATAGG - Intronic
950917518 3:16660940-16660962 AGCAGGGGCTTACAGTTCATAGG + Intronic
950920591 3:16690138-16690160 AGTAGGGGCTTCCAGGTCAAAGG + Intergenic
952107470 3:30086997-30087019 AGTGGGGGCTTCCAGGTCATAGG - Intergenic
952178346 3:30891493-30891515 AGGAGGCTGTTCCAGGTCACTGG + Intronic
952665981 3:35904918-35904940 AGTGGGGGCTTCCAGGTCATAGG + Intergenic
952687986 3:36171728-36171750 AGTTGGGGTTTCCAGGTCATAGG + Intergenic
952908575 3:38163658-38163680 AGCAGGAGCCCACAGGTCATAGG + Intergenic
953505681 3:43483808-43483830 AACAGGGGCTTACAGGTCATAGG + Intronic
954287661 3:49630199-49630221 AGGAGCAGGTTTCAGGACATGGG + Intronic
954458918 3:50615204-50615226 AGTAGAAGATTCCAGATCATAGG + Intronic
954581247 3:51704017-51704039 TGCAGGAGGGTGCAGGCCATGGG - Exonic
954716800 3:52531008-52531030 AGCAGGAGCTGCCAGGCCAGAGG + Intronic
954961685 3:54571094-54571116 AGCAGGGGCTTCCAGCTTATAGG + Intronic
955550019 3:60073810-60073832 AGCTGGAGGTTGCAGGACAGAGG - Intronic
955577334 3:60380159-60380181 GGTAGGAGGTTTTAGGTCATGGG + Intronic
956686953 3:71838622-71838644 GGGAGGGGCTTCCAGGTCATAGG - Intergenic
956713081 3:72055564-72055586 ATCAAGAGGCTCCAGGTCTTGGG + Intergenic
956752168 3:72352157-72352179 AGCAAGAGGATCCAGTTTATAGG - Intergenic
957440641 3:80242374-80242396 AGTAGGGGCTTCCAAGTCATAGG - Intergenic
957999012 3:87728157-87728179 AGCGGGGGTTACCAGGTCATAGG - Intergenic
958573781 3:95921141-95921163 AGTGGGGGCTTCCAGGTCATAGG + Intergenic
959634978 3:108555743-108555765 AGCAGGGGCTTACAGGTCATGGG - Intronic
959690249 3:109190495-109190517 GGGAGGGGTTTCCAGGTCATAGG - Intergenic
959752832 3:109858636-109858658 AGCAGGGGTTTCCAGGTCATAGG + Intergenic
959773299 3:110125736-110125758 GGAGGGAGCTTCCAGGTCATAGG - Intergenic
959776153 3:110165952-110165974 GGAGGGAGCTTCCAGGTCATAGG + Intergenic
960110099 3:113837534-113837556 AGGAGGAACTTTCAGGTCATTGG + Intronic
960425920 3:117507808-117507830 GGAAGGAGCTTCCAGGTCATAGG + Intergenic
961290280 3:125841147-125841169 AGAGGGGGCTTCCAGGTCATAGG + Intergenic
961344158 3:126251026-126251048 GGCAGGAGGTTTAAGGTTATAGG - Intergenic
961533425 3:127554507-127554529 TACAGGAGGTTCCAGGGCAGAGG - Intergenic
961706937 3:128794158-128794180 AGCAGCAGGTTACAGCTCCTAGG - Intronic
961839397 3:129696322-129696344 AGCAGGGGCTTCCAGGCTATAGG - Intronic
961896820 3:130174887-130174909 GGAAGGGGCTTCCAGGTCATAGG - Intergenic
962094943 3:132284030-132284052 AGCAGGAACTTACAGGTCATTGG + Exonic
962182791 3:133226060-133226082 AGCAAGGGCTTACAGGTCATAGG + Intronic
964157403 3:153602742-153602764 TGCAGGAGCAGCCAGGTCATGGG - Intergenic
964856091 3:161147404-161147426 AGCAGGAGTTTCCAGGTAATAGG + Intronic
964862234 3:161215657-161215679 GGCGGGGGGTTCCAGGTCATAGG - Intronic
965273218 3:166646266-166646288 AGCATCTGCTTCCAGGTCATAGG + Intergenic
966012108 3:175091934-175091956 AGCCTGAGGTCTCAGGTCATAGG + Intronic
967212683 3:187182508-187182530 AGCAGGTGATTCCAGGCCATAGG - Intergenic
967543283 3:190693919-190693941 AGTGGGGGCTTCCAGGTCATAGG - Intergenic
967593520 3:191304525-191304547 AGCAGAAGGATCCAAGTCAAAGG - Exonic
968043428 3:195608536-195608558 AGAGGGAGCTTCCAGGTCACAGG - Intergenic
969079156 4:4604892-4604914 AGCAGGAGCTTCCAGGCTATTGG - Intergenic
969509510 4:7609742-7609764 ATCCGGAGGTCCCGGGTCATGGG - Intronic
969578453 4:8050050-8050072 AGCAGGAGCTTCCAAGTTATAGG - Intronic
969655368 4:8494535-8494557 AGCAGGGGCTTCCACGTCACAGG - Intergenic
969727878 4:8934821-8934843 GGCAGGGGCTTCCAGGTCATAGG - Intergenic
969746601 4:9077619-9077641 GGAAGGGGCTTCCAGGTCATAGG + Intergenic
969805963 4:9609014-9609036 GGGAGGGGCTTCCAGGTCATAGG + Intergenic
970093222 4:12432803-12432825 AGCTGGGGGTTCCAGGCTATAGG - Intergenic
971878806 4:32340953-32340975 AGTAGGGGGTTCCAGGCCATGGG - Intergenic
972170934 4:36344423-36344445 AGCAGGGGCTTCCAGATCACAGG + Exonic
972222203 4:36968551-36968573 AGCAGGGACTTCCAGGTCATAGG + Intergenic
972374266 4:38456222-38456244 AGCAGGAGCTTCCTGCCCATGGG - Intergenic
972375276 4:38463933-38463955 AGCAGGAGGGTCCAGGAAGTGGG - Intergenic
972646079 4:40968684-40968706 AACAGGAGATTCCAGCCCATAGG - Intronic
972911995 4:43828866-43828888 AGAGGGAGCTTCCAGGTCATAGG - Intergenic
974124080 4:57674359-57674381 ATCAGGACTTTTCAGGTCATAGG + Intergenic
974627061 4:64439584-64439606 AGCGGGGGCTTCCAGGTTATTGG + Intergenic
974948030 4:68552355-68552377 GGAAGGGGCTTCCAGGTCATAGG - Intronic
974957108 4:68655633-68655655 GGAAGGGGCTTCCAGGTCATAGG - Intronic
974997570 4:69180080-69180102 AGCAGGGGCTTCCAGGTCATAGG + Intronic
975002435 4:69241039-69241061 AGCAGGGGTTTCCAGGTCATAGG + Intergenic
975007464 4:69308725-69308747 AGCGGGGGCTTCCAGGTCATAGG - Intronic
975010541 4:69345030-69345052 AGCCGGGACTTCCAGGTCATAGG + Intronic
975222380 4:71827861-71827883 AGTGGGGGCTTCCAGGTCATAGG + Intergenic
975484970 4:74925896-74925918 ACTAGGAGCTTCCAGGTCATAGG + Intergenic
975947769 4:79728399-79728421 AGCGGGGGGTTCCAGGCTATAGG - Intergenic
976362634 4:84197643-84197665 AGCAGGAGGCTGCAGCTCATTGG - Intergenic
977386557 4:96347550-96347572 AGCAGGGACTTACAGGTCATAGG + Intergenic
977486305 4:97650492-97650514 AGCAGGAGCTTCCAGGGTATAGG + Intronic
978490881 4:109310672-109310694 AGCAGGGGCTTCCAGGTCATAGG - Intergenic
979183695 4:117760335-117760357 AGCAGGGACTTCCAGATCATAGG + Intergenic
979617086 4:122755285-122755307 GGAGGGAGCTTCCAGGTCATAGG + Intergenic
980264718 4:130500596-130500618 TGGGGGAGCTTCCAGGTCATAGG - Intergenic
980306105 4:131063855-131063877 AGCTGGGGCTTCCAGGTCATAGG - Intergenic
980816326 4:137951205-137951227 AGCAGAAGTTTCCAGGTCATAGG - Intergenic
980980688 4:139652252-139652274 GGCAGGAGGGTGCAGGTCATGGG + Intergenic
980982713 4:139668099-139668121 GGCATGGGCTTCCAGGTCATAGG + Intronic
981427309 4:144618318-144618340 AGCAGGGGTTTACAGATCATAGG - Intergenic
981836650 4:149063112-149063134 ATGAGGAGGTTCCTGGTCAGTGG + Intergenic
982261170 4:153495478-153495500 GGCAGGGGCTTCCAGGTCATAGG + Intronic
982415054 4:155121232-155121254 AGTGGGGGCTTCCAGGTCATAGG - Intergenic
984962113 4:185107879-185107901 AGCAGGAGCTTCCAGGTCATAGG + Intergenic
985558755 5:570925-570947 AGCAGGAGGGTCCGGGGCAAAGG - Intergenic
986016313 5:3760648-3760670 AGCTGGTGGTTTCATGTCATGGG - Intergenic
986670502 5:10139259-10139281 AGGAGGAGGGTTCAGGTCAGGGG - Intergenic
987096615 5:14556121-14556143 GGGAGGAGCTTCCATGTCATAGG + Intergenic
987677029 5:21087736-21087758 AACAGGAGCTTCCAGGTCATAGG - Intergenic
987680452 5:21129783-21129805 AGCAGGAGCTTCCAGGTCATAGG + Intergenic
987908267 5:24106970-24106992 AGTCGGGGCTTCCAGGTCATAGG - Intronic
987965221 5:24863991-24864013 GGCAGGGGCTTCCAGGTAATAGG + Intergenic
988910833 5:35840661-35840683 GGGAGGGGGTTCCAGGTCACAGG + Intergenic
988932141 5:36047149-36047171 AGAAGGGGATTCTAGGTCATAGG - Intronic
989183959 5:38604908-38604930 AGGGGCAGCTTCCAGGTCATAGG + Intronic
989319689 5:40120557-40120579 AGAGGGAGCTTCCAGGTTATAGG - Intergenic
990186238 5:53212817-53212839 AGCAGGGGCTTCCAGGCTATAGG + Intergenic
990741718 5:58919294-58919316 AGCAGGGGTTTACAAGTCATAGG - Intergenic
991500066 5:67268083-67268105 AGCAGGAGGCTGTAGGTCAGTGG + Intergenic
992164823 5:74039028-74039050 AGTGGGAGCTTCCAGGTCATAGG - Intergenic
993474902 5:88352429-88352451 TACAGGAAGTTCAAGGTCATTGG + Intergenic
993652838 5:90542843-90542865 GGCAGGGGCTTCCAGGTCATAGG + Intronic
993722304 5:91333798-91333820 AGGAGGGGCTTCCAGGTCATAGG - Intergenic
994835304 5:104844198-104844220 AGCAGGGGCTTACGGGTCATAGG - Intergenic
994867431 5:105294121-105294143 AGCAGGGGCTTACAGGCCATAGG - Intergenic
995109846 5:108417101-108417123 AGCAGGAGCTTCTAGGTCATAGG - Intergenic
995593446 5:113723810-113723832 GGGAGGGGTTTCCAGGTCATAGG + Intergenic
995596881 5:113756868-113756890 AGCAGGAGCTTCCTGGTCATAGG - Intergenic
996322250 5:122231983-122232005 AGCTGGGGCTTGCAGGTCATAGG + Intergenic
996814028 5:127554246-127554268 AGCAGGAGGTTCAAGGAAATGGG - Exonic
997158827 5:131585868-131585890 AGAGGGGGCTTCCAGGTCATAGG - Intronic
997458719 5:134037580-134037602 AGCAGGGGCTTACAGGTCATAGG - Intergenic
998033320 5:138892016-138892038 GGAAGGGGCTTCCAGGTCATAGG - Intronic
1000344111 5:160300153-160300175 AGCAGATGGTTCCAGGCCCTGGG - Intronic
1000363800 5:160472572-160472594 AGCAGGGGCTTCCAGGCTATAGG + Intergenic
1000551279 5:162668136-162668158 AGCAGGGGCTTACAGGTCATAGG + Intergenic
1000903153 5:166932837-166932859 AGCAGGGGCTTCCAGGTTATAGG + Intergenic
1002870001 6:1158038-1158060 AGCAGGGGCTTCCAGGTCATAGG - Intergenic
1003015209 6:2462512-2462534 AGCCTGAGTTTCCAGGCCATCGG - Intergenic
1003067181 6:2913708-2913730 AGCAGGGGCTTCCAGGTCATAGG + Intergenic
1003075397 6:2979574-2979596 AGTGGGGGCTTCCAGGTCATAGG - Intergenic
1003321384 6:5055144-5055166 AGCAGGGTCTTCGAGGTCATAGG - Intergenic
1003352245 6:5328819-5328841 AGCAGAAGGTTCCAGGACATGGG - Intronic
1004125504 6:12868972-12868994 AGTAGTCGGTTCCAGGTCTTGGG + Intronic
1004481114 6:16020113-16020135 AGAGGGAGCTTCCAGGTCATAGG - Intergenic
1005641130 6:27797503-27797525 GGGGGAAGGTTCCAGGTCATAGG - Intergenic
1005718571 6:28577854-28577876 AGAAGGGGCTTACAGGTCATAGG - Intronic
1008730285 6:54473822-54473844 AGCAGCGGCTTCCAGGTTATAGG - Intergenic
1008977835 6:57448629-57448651 AGCAGGGACTTACAGGTCATAGG + Intronic
1009165983 6:60341576-60341598 AGCAGGGACTTACAGGTCATAGG + Intergenic
1010158445 6:72822949-72822971 AGCAGGAGGGTCCAAGTCAGAGG - Intronic
1011594753 6:89005735-89005757 AGCAGGGACTTCCAGGTCATAGG - Intergenic
1012211178 6:96520865-96520887 GGGAGGAAGTTCCAAGTCATAGG + Intergenic
1014171939 6:118288440-118288462 AGCAGAGGCTTCCAGGTCACAGG + Intronic
1014753265 6:125276373-125276395 AGAAAGAGATTCCAGGTCCTGGG + Intronic
1014816309 6:125939487-125939509 AGCAGGGGCTTCCAGGCTATAGG - Intergenic
1014871466 6:126601700-126601722 GGGATGAGGTTCCAGGTCAGGGG - Intergenic
1014887456 6:126798910-126798932 GGCAGGGGCTTCCAGGTCATAGG + Intergenic
1015167236 6:130211609-130211631 AGCTGGGGCTTCCAGGTCACAGG - Intronic
1015332939 6:132002772-132002794 AGCAGGGGCTTCCAGGCCATAGG + Intergenic
1015824273 6:137295208-137295230 AGCAGGGGCTTCCAGGTCATAGG - Intergenic
1015986679 6:138891593-138891615 ATTAGGGGCTTCCAGGTCATGGG - Intronic
1016513350 6:144867732-144867754 AGCAGGGCCTTCCAGGTCATAGG + Intergenic
1016547233 6:145238069-145238091 AGCAGGGGCTTCCAGGCTATTGG - Intergenic
1016920675 6:149289915-149289937 AGCAGGGAGTTCCAGGTCATAGG + Intronic
1017100592 6:150846632-150846654 AGCAGGCAGTTCCACCTCATTGG + Intergenic
1018077115 6:160227396-160227418 AGCAGGGGCTTCCAGGTCATAGG - Intronic
1018138428 6:160802264-160802286 AGAGGGGGTTTCCAGGTCATAGG - Intergenic
1018480115 6:164181584-164181606 TGCAGGGGCTTCCAGGTCATAGG - Intergenic
1018759351 6:166877665-166877687 AGCAGGGGCCTCCAGGTCATAGG + Intronic
1018807666 6:167273747-167273769 AGCAGGGGCTTCCAGATCACAGG + Intronic
1018808865 6:167282859-167282881 AGCAGGGGCTTCCGGGTCAGAGG + Intronic
1018903117 6:168060979-168061001 AGCAGGAGCTTCCCGGGCAGTGG - Exonic
1019046099 6:169147388-169147410 AGCACGGGCTTCCAGGTTATAGG - Intergenic
1019068441 6:169322120-169322142 AGCAGGGGCTTCCAGGTCACAGG + Intergenic
1019107049 6:169676765-169676787 AGTGGGGGCTTCCAGGTCATAGG - Intronic
1019823189 7:3261489-3261511 AACAGGGGCGTCCAGGTCATAGG + Intergenic
1020327506 7:6986563-6986585 GGTAGGGGCTTCCAGGTCATAGG - Intergenic
1020726529 7:11821701-11821723 TGTAGGAGGTTCCAAGTCACAGG - Intronic
1021636493 7:22699240-22699262 AGCAGGACCTTGCAGGACATGGG + Intergenic
1021788039 7:24172311-24172333 AGCACGGGCTTACAGGTCATAGG - Intergenic
1022804512 7:33808065-33808087 AGGAGGTGGTTGCAGGTCACTGG + Intergenic
1022985428 7:35649636-35649658 AGCAGGGGCTTCCAGGTTATAGG + Intronic
1023736005 7:43236555-43236577 AGCAGGAACTTCCAGGTCATAGG + Intronic
1024317958 7:48038872-48038894 GGGGGGTGGTTCCAGGTCATAGG + Intronic
1024668356 7:51567345-51567367 AGCAGTTATTTCCAGGTCATGGG + Intergenic
1024821579 7:53337077-53337099 GGCAGGGGCTTCCAGGTCACAGG - Intergenic
1025929303 7:65981843-65981865 CGCAGGAGGTTAAAGGTCAACGG - Intronic
1026119223 7:67522162-67522184 AGCAGGAGCTTTCAGGTCATAGG - Intergenic
1026291613 7:69011481-69011503 ATTGGGAGCTTCCAGGTCATAGG + Intergenic
1026501340 7:70945784-70945806 AGGAGAAGCTTACAGGTCATAGG - Intergenic
1026561859 7:71456944-71456966 AGCGGGGGGTTCCAGGTCACAGG + Intronic
1026984245 7:74544994-74545016 ACCAGGAAGTTCCTGGTCAAAGG + Intronic
1027164591 7:75825427-75825449 AGCAGGGGGTTCCAGGCCAAGGG + Intergenic
1027517161 7:79156588-79156610 AGCAGGAGCTTCCAGGTTATAGG - Intronic
1027616594 7:80431613-80431635 AGCAAGGGCTTCCAGGTCATAGG + Intronic
1027632821 7:80628865-80628887 GGCAGGGGGTCCCAGGTCATAGG + Intronic
1028077937 7:86537666-86537688 AGCAGGGAGTTACAGATCATAGG + Intergenic
1028318463 7:89433623-89433645 AGCAGGGGCTTCCAGGCTATAGG + Intergenic
1028389390 7:90296773-90296795 AGCAGGAGTTTACAGGTCAGAGG + Intronic
1028446845 7:90934196-90934218 GGCAGCAGGTTCCAGCTGATAGG - Intronic
1028788594 7:94826439-94826461 AGCAAGTACTTCCAGGTCATAGG - Intergenic
1029546446 7:101212774-101212796 AGCAGGAGGTACAAGGACAGCGG - Intronic
1030877416 7:114832189-114832211 GGGAGGGGCTTCCAGGTCATAGG + Intergenic
1032700375 7:134373720-134373742 GGAAGGGGCTTCCAGGTCATAGG + Intergenic
1032801311 7:135319339-135319361 GGGGGGGGGTTCCAGGTCATAGG - Intergenic
1033577168 7:142696506-142696528 AGAGGGGGCTTCCAGGTCATAGG + Intergenic
1034000195 7:147403226-147403248 AGCAGGGGCTCCCAGGTGATAGG - Intronic
1034015891 7:147586064-147586086 GGCAGGGGCTTCCAGGTTATAGG + Intronic
1034109916 7:148527039-148527061 TGCAGGGACTTCCAGGTCATGGG - Intergenic
1034223816 7:149466968-149466990 AGCAGGGCCTTCCAGGACATAGG + Intergenic
1035157876 7:156928930-156928952 GGCAGGGGCTTCCAGGTCATAGG + Intergenic
1035346296 7:158201790-158201812 AGCAGGGGCTTCCAGGCTATAGG - Intronic
1035359898 7:158304630-158304652 AGCAGGGTCTTCCAGGGCATAGG + Intronic
1035687061 8:1532015-1532037 CAGAGGGGGTTCCAGGTCATAGG + Intronic
1035919716 8:3663673-3663695 AGAAGGGGTTTCCAGTTCATAGG - Intronic
1035952137 8:4033483-4033505 AGTGGGAGCTTCCAGGTCATAGG - Intronic
1036369111 8:8147534-8147556 GGAAGGGGCTTCCAGGTCATTGG + Intergenic
1036488610 8:9202616-9202638 AGCAGGAGCTCACAGGTCATAGG - Intergenic
1036583836 8:10104494-10104516 ATCAGGGGCTTCTAGGTCATAGG + Intronic
1036614172 8:10375608-10375630 AGCAGCAAGTTCCTGGGCATTGG + Intronic
1036881779 8:12518108-12518130 GGAAGGGGCTTCCAGGTCATTGG - Intergenic
1037475397 8:19252195-19252217 AGCGTGGGCTTCCAGGTCATAGG - Intergenic
1037774451 8:21823710-21823732 AACAGGAGCTTCCAGGTCAGAGG + Intergenic
1037787229 8:21910309-21910331 AGCTGGAGGTCCCAGGGCTTGGG - Intronic
1037878515 8:22561305-22561327 AGCAGAAGGGACCAGGTCATGGG - Intronic
1038458368 8:27693865-27693887 AGGAGGGGCTTCCAGGTCATAGG - Intergenic
1038665136 8:29531304-29531326 AGCAGGGGCTTACAGGTCACGGG - Intergenic
1039018584 8:33180721-33180743 CACAGGGGCTTCCAGGTCATAGG + Intergenic
1039685323 8:39795543-39795565 AGCAGGTTCTTCCAGGTCATAGG - Intronic
1039952992 8:42186444-42186466 AGCAAGGGCTTCCAGGCCATAGG - Intronic
1039955684 8:42205658-42205680 AGTAGGGGCTTCCAGGTCATAGG - Intronic
1039973635 8:42341306-42341328 GGCAAGTAGTTCCAGGTCATTGG - Intronic
1040010583 8:42658009-42658031 AGCAGGGGCTTACAGGTCATAGG + Intergenic
1040417317 8:47206787-47206809 AGCAGGGGCTTACAGGTCATAGG + Intergenic
1040664622 8:49618332-49618354 AGCAGGGGCTTCCAGGCGATAGG - Intergenic
1041320492 8:56607434-56607456 AGTAGGGGCTTCTAGGTCATAGG - Intergenic
1041479050 8:58297887-58297909 GGAGGGAGCTTCCAGGTCATAGG - Intergenic
1042184485 8:66123207-66123229 AGTGGGGGCTTCCAGGTCATAGG - Intergenic
1042820296 8:72923032-72923054 GGGGGGAGCTTCCAGGTCATAGG + Intronic
1044013321 8:87021023-87021045 AGCAGGGGCTTCCAGGCTATAGG - Intronic
1045044088 8:98257851-98257873 AGTGGGGGCTTCCAGGTCATGGG - Intronic
1045049518 8:98310073-98310095 AGCAGGGGCTTACCGGTCATTGG + Intergenic
1045558204 8:103235366-103235388 GGCAGGAGTTGCCAGGGCATTGG + Intergenic
1046673544 8:117083884-117083906 ATCAGGAGGATCAAGGACATGGG - Intronic
1047114274 8:121823246-121823268 AGCAGGGGCTTCCAGGTTATAGG + Intergenic
1047135152 8:122069601-122069623 AGTGGGGGCTTCCAGGTCATAGG + Intergenic
1048103563 8:131382021-131382043 AGCAGGAGCTTACAGGTAATAGG - Intergenic
1049429425 8:142552520-142552542 AACAGAAGCTTCCAGGTCATAGG + Intergenic
1049449456 8:142652450-142652472 GGCAGGGGCTTCCAGGTCATAGG + Intergenic
1049523803 8:143110201-143110223 AACAGGGACTTCCAGGTCATAGG - Intergenic
1049544464 8:143223240-143223262 AGCAGGGGCTTCCAGGCCACAGG + Intergenic
1050352743 9:4755811-4755833 AGCAGGAGCTTACAGGTCATAGG + Intergenic
1050830769 9:10009420-10009442 AGCAGGGGTTTCCAGGTCATAGG + Intronic
1051065683 9:13099545-13099567 AGCTGGAGCTTCCAAGTCATAGG - Intergenic
1052171066 9:25397191-25397213 AGCAGGAGCTTCCAGGTCACAGG - Intergenic
1052180475 9:25520006-25520028 AGGGGGTGCTTCCAGGTCATAGG - Intergenic
1052190368 9:25654453-25654475 AGCGGAGGCTTCCAGGTCATAGG + Intergenic
1052563542 9:30116866-30116888 AGGAGGGGCTTCCACGTCATAGG + Intergenic
1053017215 9:34669037-34669059 AGTGGGGGCTTCCAGGTCATAGG - Intergenic
1053060579 9:35027882-35027904 AGCAGGGGCTTCCAGGTCATAGG + Intergenic
1054722044 9:68614082-68614104 TGCAGGAGGCTCCATGTCTTTGG - Intergenic
1055108601 9:72537758-72537780 AGTGGGGGCTTCCAGGTCATAGG + Intronic
1055450135 9:76423448-76423470 ACTAGGAAGTTCAAGGTCATGGG - Intronic
1055568934 9:77596855-77596877 GGGAGGGGCTTCCAGGTCATAGG - Intronic
1055992922 9:82127424-82127446 ATCAGTAGTTTCCAGGGCATAGG + Intergenic
1056066371 9:82939697-82939719 AATAGGAGGTTCCAGGTCGGTGG - Intergenic
1056391225 9:86143359-86143381 AGCAGGGGCTTACAGGTCATAGG - Intergenic
1056775250 9:89507576-89507598 AGTGGGGGCTTCCAGGTCATGGG + Intergenic
1056902067 9:90609092-90609114 AGTGGGGGCTTCCAGGTCATAGG + Intergenic
1056921249 9:90791110-90791132 AGTGGGAGTTTCCAGGTCATAGG + Intergenic
1057690193 9:97277060-97277082 GGAAGGGGCTTCCAGGTCATAGG + Intergenic
1057943972 9:99308650-99308672 AGCAGGGGCTTACAGGTCAATGG - Intergenic
1058001374 9:99869429-99869451 AGTGGGAGCTTACAGGTCATTGG + Intergenic
1058286872 9:103189398-103189420 AGAAGGGGCTTTCAGGTCATAGG + Intergenic
1058531846 9:105913795-105913817 AGCAGGGGCTTCCAGGTCACAGG - Intergenic
1059214525 9:112548311-112548333 AGAGGGTGCTTCCAGGTCATAGG - Intronic
1059782370 9:117543508-117543530 TGGAGGAGGCTCCAGGTCTTTGG + Intergenic
1060186051 9:121564806-121564828 AACAGGAGGGTCCAGGCCAGGGG - Intergenic
1061375170 9:130219837-130219859 AGCTGGAGGGCCCAGGTCAGAGG + Intronic
1062258824 9:135647111-135647133 AGCAGGTGCTTTCAGGTTATAGG - Intergenic
1185740011 X:2524132-2524154 AGAGGGAGCTTCCAGGTCACAGG - Intergenic
1185773667 X:2785100-2785122 AGCAGGGGCTTCCAGGTCACAGG + Intronic
1185975971 X:4720400-4720422 AGCAGGGGCTTCCAGGTCATAGG - Intergenic
1185990617 X:4890965-4890987 AGCAGAGGCTTTCAGGTCATAGG + Intergenic
1185991581 X:4897364-4897386 AGCAGAGGCTTTCAGGTCATAGG + Intergenic
1186148028 X:6645257-6645279 AGCAGGGGCTTCCAGGTTATAGG + Intergenic
1186176330 X:6929402-6929424 AGCAAGGGCTTCCAGGTCACAGG + Intergenic
1186526079 X:10249532-10249554 GGCAGGAGGGTCCAAGTCAGAGG + Intergenic
1188366087 X:29316640-29316662 AGCAGGGGCTTACAGGTCATAGG + Intronic
1188554919 X:31400314-31400336 AGGAGGGGCTTCCAGGTCACAGG - Intronic
1188876002 X:35430930-35430952 AGCAGGGGCTTCCAGGTTACAGG + Intergenic
1188876083 X:35431732-35431754 AGCAGGGGCTTCCAGGCTATAGG + Intergenic
1188904955 X:35780511-35780533 AGCATGGGCTACCAGGTCATAGG + Intergenic
1188979595 X:36715035-36715057 ACCAGGAGGTTCAAGGTGAGAGG + Intergenic
1189092848 X:38105457-38105479 GGAGGGAGCTTCCAGGTCATAGG + Intronic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1189214906 X:39314520-39314542 AGCAAGAGCATCCAGTTCATGGG + Intergenic
1189465930 X:41277349-41277371 AGAAGGACGTTATAGGTCATGGG - Intergenic
1189634582 X:42992517-42992539 AGCAGGACCTTACAGGTTATAGG - Intergenic
1189893298 X:45628119-45628141 AGCAGGGGTTTACAGGTCATAGG + Intergenic
1190179020 X:48175727-48175749 AGCAGGAGCTTCCAGCTTATAGG - Intergenic
1190185140 X:48227097-48227119 AGCAGGGGCTTCCAGCTTATGGG - Intronic
1190197870 X:48335134-48335156 AGCAGGGGCTTCCAGTTTATAGG - Intergenic
1190387607 X:49898135-49898157 AGCAGAAGGTGCCAAGTCTTGGG - Intergenic
1190408265 X:50109450-50109472 AGCAGGAGCTTCCAGGTAATAGG - Intergenic
1190524497 X:51314720-51314742 AGCAGTAGATTCCAGGTATTAGG - Intergenic
1190951808 X:55153033-55153055 AGCTGCGGCTTCCAGGTCATAGG - Intronic
1192209781 X:69120494-69120516 GGCAGGAGGATGGAGGTCATAGG - Intergenic
1192283021 X:69704219-69704241 AGCTGGGGTTTCCAGGTCATAGG + Intronic
1192732054 X:73810302-73810324 AGTGGGGGCTTCCAGGTCATAGG - Intergenic
1192803600 X:74491321-74491343 AGCTGGGGCTTCCAGGCCATAGG + Intronic
1192834251 X:74782409-74782431 GGCAGGAGGTTCAGGGTCTTAGG + Intronic
1193372148 X:80711774-80711796 CGGAGGAGGTTCCAGGTCATAGG - Intronic
1193441754 X:81549262-81549284 AGCAGGGCCTTCCAGGTCATAGG - Intergenic
1193681537 X:84525529-84525551 CGGTGGAGCTTCCAGGTCATAGG - Intergenic
1194092297 X:89592865-89592887 AGCAGGGGCTTTCAGGTCATAGG - Intergenic
1194121840 X:89972062-89972084 AGGAGGGGCTTCCAGGTCACAGG - Intergenic
1194186828 X:90781044-90781066 AGTAGGGGCTTCCAGGTCATGGG - Intergenic
1194205395 X:91005611-91005633 AGAAGGGGCTTCCAGGTCACAGG + Intergenic
1194205920 X:91010920-91010942 AGCAGGGGCTTCCAGGCTATTGG - Intergenic
1194262212 X:91710311-91710333 AGCAGGGGCTTCCAAGTCATGGG + Intergenic
1194266863 X:91764844-91764866 AGCAGGGGCTTCCAGGTCATAGG - Intergenic
1194279798 X:91935816-91935838 AGCAGGGGCTTCCAGGCCATAGG + Intronic
1194476534 X:94366048-94366070 TGGAGGGGCTTCCAGGTCATAGG - Intergenic
1194501204 X:94683703-94683725 AGTGGGAGCTTTCAGGTCATAGG + Intergenic
1195463426 X:105153701-105153723 AGCAGGGGCTTCCAGGTCATAGG + Intronic
1195540126 X:106054193-106054215 AGAGGGGGCTTCCAGGTCATAGG - Intergenic
1195558169 X:106251066-106251088 AGTGGGGGCTTCCAGGTCATAGG - Intergenic
1195565668 X:106336432-106336454 AGTGGGGGCTTCCAGGTCATAGG + Intergenic
1195566557 X:106345833-106345855 AGCACGGGCTTCAAGGTCATAGG + Intergenic
1195657245 X:107343845-107343867 AGCAGGGGCTTACAGGTTATAGG - Intergenic
1196566746 X:117215425-117215447 AGAGGGAGCTTCCAGGTCATAGG + Intergenic
1196772615 X:119309909-119309931 GGAGGGAGCTTCCAGGTCATAGG - Intergenic
1196966794 X:121065091-121065113 AACATGAAGTTCCAGATCATGGG - Intergenic
1197376425 X:125687386-125687408 GGAGGGAGCTTCCAGGTCATAGG + Intergenic
1199103323 X:143832674-143832696 AACAGGAAATTCTAGGTCATAGG - Intergenic
1199579669 X:149348575-149348597 AGCAGCAGCTTATAGGTCATAGG - Intergenic
1199622978 X:149715534-149715556 AGCAGGAGGCTCCAGGACTGAGG - Intronic
1200444927 Y:3248902-3248924 AGCAGGGGCTTTCAGGTCATAGG - Intergenic
1200474693 Y:3629499-3629521 AGGAGGGGCTTCCAGGTCACAGG - Intergenic
1200533424 Y:4363118-4363140 AGTAGGGGCTTCCAGGTCATGGG - Intergenic
1200551212 Y:4580754-4580776 AGAAGGGGCTTCCAGGTCACAGG + Intergenic
1200551676 Y:4585728-4585750 AGCAGGGGCTTCCAGGCTATTGG - Intergenic
1200581506 Y:4955144-4955166 AGCAGGGGCTTCCAAGTCATGGG + Intergenic
1200584063 Y:4985756-4985778 AGCAGGGGCTTCCAGGTCATAGG - Intergenic
1200597275 Y:5159297-5159319 AGCAGGGGCTTCCAGGCCATAGG + Intronic
1200802970 Y:7403052-7403074 AGTAGGGGCTTCGAGGTCATAGG + Intergenic
1201255637 Y:12105844-12105866 AGTGGGAACTTCCAGGTCATGGG - Intergenic
1201263959 Y:12187960-12187982 TGGGGGAGCTTCCAGGTCATAGG - Intergenic
1201296222 Y:12465480-12465502 AGCAGGGGCTTCCAGGTCATAGG - Intergenic