ID: 916312510

View in Genome Browser
Species Human (GRCh38)
Location 1:163412614-163412636
Sequence CCAACTCTGGACAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916312501_916312510 23 Left 916312501 1:163412568-163412590 CCTCTCCAGCTTTAGAACAGAAC No data
Right 916312510 1:163412614-163412636 CCAACTCTGGACAAGGAGGAAGG No data
916312502_916312510 18 Left 916312502 1:163412573-163412595 CCAGCTTTAGAACAGAACAGCAC No data
Right 916312510 1:163412614-163412636 CCAACTCTGGACAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916312510 Original CRISPR CCAACTCTGGACAAGGAGGA AGG Intergenic
No off target data available for this crispr