ID: 916314862

View in Genome Browser
Species Human (GRCh38)
Location 1:163437960-163437982
Sequence CTCGGTTTACAGACGGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916314862_916314871 25 Left 916314862 1:163437960-163437982 CCATTCCCCGTCTGTAAACCGAG No data
Right 916314871 1:163438008-163438030 TGTGAGGTTAAGAGAGAATGTGG No data
916314862_916314867 9 Left 916314862 1:163437960-163437982 CCATTCCCCGTCTGTAAACCGAG No data
Right 916314867 1:163437992-163438014 TCCCAACCTGAAGAATTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916314862 Original CRISPR CTCGGTTTACAGACGGGGAA TGG (reversed) Intergenic
No off target data available for this crispr