ID: 916314958

View in Genome Browser
Species Human (GRCh38)
Location 1:163438753-163438775
Sequence GTCCCATGTCAACAAGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916314958_916314966 21 Left 916314958 1:163438753-163438775 CCCTTCCCTTGTTGACATGGGAC No data
Right 916314966 1:163438797-163438819 GAGACATGAAGATGCAAAAGTGG No data
916314958_916314967 29 Left 916314958 1:163438753-163438775 CCCTTCCCTTGTTGACATGGGAC No data
Right 916314967 1:163438805-163438827 AAGATGCAAAAGTGGCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916314958 Original CRISPR GTCCCATGTCAACAAGGGAA GGG (reversed) Intergenic
No off target data available for this crispr