ID: 916318145

View in Genome Browser
Species Human (GRCh38)
Location 1:163473207-163473229
Sequence GGAAAATGGTCTCTGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916318145_916318149 2 Left 916318145 1:163473207-163473229 CCAGCACACAGAGACCATTTTCC No data
Right 916318149 1:163473232-163473254 TGAATGCGACGGAAAACACTTGG No data
916318145_916318151 12 Left 916318145 1:163473207-163473229 CCAGCACACAGAGACCATTTTCC No data
Right 916318151 1:163473242-163473264 GGAAAACACTTGGAGAGACAGGG No data
916318145_916318147 -9 Left 916318145 1:163473207-163473229 CCAGCACACAGAGACCATTTTCC No data
Right 916318147 1:163473221-163473243 CCATTTTCCACTGAATGCGACGG No data
916318145_916318150 11 Left 916318145 1:163473207-163473229 CCAGCACACAGAGACCATTTTCC No data
Right 916318150 1:163473241-163473263 CGGAAAACACTTGGAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916318145 Original CRISPR GGAAAATGGTCTCTGTGTGC TGG (reversed) Intergenic
No off target data available for this crispr