ID: 916320660

View in Genome Browser
Species Human (GRCh38)
Location 1:163499702-163499724
Sequence GGACTGTACTGCCATGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34810
Summary {0: 22, 1: 36, 2: 85, 3: 1884, 4: 32783}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916320660_916320669 18 Left 916320660 1:163499702-163499724 CCAAGATCATGGCAGTACAGTCC 0: 22
1: 36
2: 85
3: 1884
4: 32783
Right 916320669 1:163499743-163499765 AGACCGTAGAAGGAGGGAGACGG No data
916320660_916320668 12 Left 916320660 1:163499702-163499724 CCAAGATCATGGCAGTACAGTCC 0: 22
1: 36
2: 85
3: 1884
4: 32783
Right 916320668 1:163499737-163499759 AGAGGGAGACCGTAGAAGGAGGG No data
916320660_916320666 8 Left 916320660 1:163499702-163499724 CCAAGATCATGGCAGTACAGTCC 0: 22
1: 36
2: 85
3: 1884
4: 32783
Right 916320666 1:163499733-163499755 CAAGAGAGGGAGACCGTAGAAGG No data
916320660_916320663 -5 Left 916320660 1:163499702-163499724 CCAAGATCATGGCAGTACAGTCC 0: 22
1: 36
2: 85
3: 1884
4: 32783
Right 916320663 1:163499720-163499742 AGTCCAGGCTCCACAAGAGAGGG No data
916320660_916320662 -6 Left 916320660 1:163499702-163499724 CCAAGATCATGGCAGTACAGTCC 0: 22
1: 36
2: 85
3: 1884
4: 32783
Right 916320662 1:163499719-163499741 CAGTCCAGGCTCCACAAGAGAGG No data
916320660_916320667 11 Left 916320660 1:163499702-163499724 CCAAGATCATGGCAGTACAGTCC 0: 22
1: 36
2: 85
3: 1884
4: 32783
Right 916320667 1:163499736-163499758 GAGAGGGAGACCGTAGAAGGAGG No data
916320660_916320671 30 Left 916320660 1:163499702-163499724 CCAAGATCATGGCAGTACAGTCC 0: 22
1: 36
2: 85
3: 1884
4: 32783
Right 916320671 1:163499755-163499777 GAGGGAGACGGAGAGCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916320660 Original CRISPR GGACTGTACTGCCATGATCT TGG (reversed) Intergenic
Too many off-targets to display for this crispr