ID: 916320662

View in Genome Browser
Species Human (GRCh38)
Location 1:163499719-163499741
Sequence CAGTCCAGGCTCCACAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916320658_916320662 18 Left 916320658 1:163499678-163499700 CCAAGGCAGGGAGGTTGCAGCGA 0: 44
1: 25
2: 30
3: 193
4: 1920
Right 916320662 1:163499719-163499741 CAGTCCAGGCTCCACAAGAGAGG No data
916320660_916320662 -6 Left 916320660 1:163499702-163499724 CCAAGATCATGGCAGTACAGTCC 0: 22
1: 36
2: 85
3: 1884
4: 32783
Right 916320662 1:163499719-163499741 CAGTCCAGGCTCCACAAGAGAGG No data
916320657_916320662 19 Left 916320657 1:163499677-163499699 CCCAAGGCAGGGAGGTTGCAGCG No data
Right 916320662 1:163499719-163499741 CAGTCCAGGCTCCACAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916320662 Original CRISPR CAGTCCAGGCTCCACAAGAG AGG Intergenic
No off target data available for this crispr