ID: 916320666 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:163499733-163499755 |
| Sequence | CAAGAGAGGGAGACCGTAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 916320660_916320666 | 8 | Left | 916320660 | 1:163499702-163499724 | CCAAGATCATGGCAGTACAGTCC | 0: 22 1: 36 2: 85 3: 1884 4: 32783 |
||
| Right | 916320666 | 1:163499733-163499755 | CAAGAGAGGGAGACCGTAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 916320666 | Original CRISPR | CAAGAGAGGGAGACCGTAGA AGG | Intergenic | ||
| No off target data available for this crispr | |||||