ID: 916320667

View in Genome Browser
Species Human (GRCh38)
Location 1:163499736-163499758
Sequence GAGAGGGAGACCGTAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916320660_916320667 11 Left 916320660 1:163499702-163499724 CCAAGATCATGGCAGTACAGTCC 0: 22
1: 36
2: 85
3: 1884
4: 32783
Right 916320667 1:163499736-163499758 GAGAGGGAGACCGTAGAAGGAGG No data
916320664_916320667 -10 Left 916320664 1:163499723-163499745 CCAGGCTCCACAAGAGAGGGAGA No data
Right 916320667 1:163499736-163499758 GAGAGGGAGACCGTAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916320667 Original CRISPR GAGAGGGAGACCGTAGAAGG AGG Intergenic
No off target data available for this crispr