ID: 916320669

View in Genome Browser
Species Human (GRCh38)
Location 1:163499743-163499765
Sequence AGACCGTAGAAGGAGGGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916320664_916320669 -3 Left 916320664 1:163499723-163499745 CCAGGCTCCACAAGAGAGGGAGA No data
Right 916320669 1:163499743-163499765 AGACCGTAGAAGGAGGGAGACGG No data
916320665_916320669 -10 Left 916320665 1:163499730-163499752 CCACAAGAGAGGGAGACCGTAGA 0: 9
1: 8
2: 32
3: 135
4: 111
Right 916320669 1:163499743-163499765 AGACCGTAGAAGGAGGGAGACGG No data
916320660_916320669 18 Left 916320660 1:163499702-163499724 CCAAGATCATGGCAGTACAGTCC 0: 22
1: 36
2: 85
3: 1884
4: 32783
Right 916320669 1:163499743-163499765 AGACCGTAGAAGGAGGGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916320669 Original CRISPR AGACCGTAGAAGGAGGGAGA CGG Intergenic
No off target data available for this crispr