ID: 916321411

View in Genome Browser
Species Human (GRCh38)
Location 1:163509046-163509068
Sequence GGTATTGATTAGGATATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916321411_916321416 29 Left 916321411 1:163509046-163509068 CCTTCTATATCCTAATCAATACC No data
Right 916321416 1:163509098-163509120 CTTTCTTTTGAAAACTGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916321411 Original CRISPR GGTATTGATTAGGATATAGA AGG (reversed) Intergenic
No off target data available for this crispr