ID: 916321416

View in Genome Browser
Species Human (GRCh38)
Location 1:163509098-163509120
Sequence CTTTCTTTTGAAAACTGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916321414_916321416 -4 Left 916321414 1:163509079-163509101 CCTGTTAACCACATACATACTTT No data
Right 916321416 1:163509098-163509120 CTTTCTTTTGAAAACTGTATTGG No data
916321411_916321416 29 Left 916321411 1:163509046-163509068 CCTTCTATATCCTAATCAATACC No data
Right 916321416 1:163509098-163509120 CTTTCTTTTGAAAACTGTATTGG No data
916321413_916321416 8 Left 916321413 1:163509067-163509089 CCTTGAAATAATCCTGTTAACCA No data
Right 916321416 1:163509098-163509120 CTTTCTTTTGAAAACTGTATTGG No data
916321412_916321416 19 Left 916321412 1:163509056-163509078 CCTAATCAATACCTTGAAATAAT No data
Right 916321416 1:163509098-163509120 CTTTCTTTTGAAAACTGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916321416 Original CRISPR CTTTCTTTTGAAAACTGTAT TGG Intergenic
No off target data available for this crispr