ID: 916329571

View in Genome Browser
Species Human (GRCh38)
Location 1:163599625-163599647
Sequence GGGGAGGCTGACTCCACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916329571_916329580 17 Left 916329571 1:163599625-163599647 CCTGCAGTGGAGTCAGCCTCCCC No data
Right 916329580 1:163599665-163599687 CCCTTACAACACAGTGGTAGTGG No data
916329571_916329578 11 Left 916329571 1:163599625-163599647 CCTGCAGTGGAGTCAGCCTCCCC No data
Right 916329578 1:163599659-163599681 TATCAGCCCTTACAACACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916329571 Original CRISPR GGGGAGGCTGACTCCACTGC AGG (reversed) Intergenic
No off target data available for this crispr