ID: 916332635

View in Genome Browser
Species Human (GRCh38)
Location 1:163634436-163634458
Sequence TACTTCCCAAGTTATATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916332631_916332635 8 Left 916332631 1:163634405-163634427 CCAGAGTAGTTTCTTCTCACAGT No data
Right 916332635 1:163634436-163634458 TACTTCCCAAGTTATATCCAGGG No data
916332630_916332635 9 Left 916332630 1:163634404-163634426 CCCAGAGTAGTTTCTTCTCACAG No data
Right 916332635 1:163634436-163634458 TACTTCCCAAGTTATATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916332635 Original CRISPR TACTTCCCAAGTTATATCCA GGG Intergenic
No off target data available for this crispr