ID: 916337802

View in Genome Browser
Species Human (GRCh38)
Location 1:163692829-163692851
Sequence GCTTGTATTGCTCCGCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916337801_916337802 -8 Left 916337801 1:163692814-163692836 CCTTGATGCTCAGCTGCTTGTAT No data
Right 916337802 1:163692829-163692851 GCTTGTATTGCTCCGCCAGCTGG No data
916337800_916337802 2 Left 916337800 1:163692804-163692826 CCACTTGTATCCTTGATGCTCAG No data
Right 916337802 1:163692829-163692851 GCTTGTATTGCTCCGCCAGCTGG No data
916337799_916337802 10 Left 916337799 1:163692796-163692818 CCGTTCAGCCACTTGTATCCTTG No data
Right 916337802 1:163692829-163692851 GCTTGTATTGCTCCGCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916337802 Original CRISPR GCTTGTATTGCTCCGCCAGC TGG Intergenic
No off target data available for this crispr