ID: 916339768

View in Genome Browser
Species Human (GRCh38)
Location 1:163718934-163718956
Sequence ACCCTTCCTTCTGTTTGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916339767_916339768 11 Left 916339767 1:163718900-163718922 CCATTTCACACTTTTCTCTTTTT No data
Right 916339768 1:163718934-163718956 ACCCTTCCTTCTGTTTGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916339768 Original CRISPR ACCCTTCCTTCTGTTTGTTG TGG Intergenic
No off target data available for this crispr