ID: 916341775

View in Genome Browser
Species Human (GRCh38)
Location 1:163744956-163744978
Sequence TCTCTTCTTTTTACAGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916341772_916341775 -2 Left 916341772 1:163744935-163744957 CCAAAATCCTTCTCACTCTTCTC No data
Right 916341775 1:163744956-163744978 TCTCTTCTTTTTACAGGCAGAGG No data
916341771_916341775 5 Left 916341771 1:163744928-163744950 CCTGAGACCAAAATCCTTCTCAC No data
Right 916341775 1:163744956-163744978 TCTCTTCTTTTTACAGGCAGAGG No data
916341773_916341775 -9 Left 916341773 1:163744942-163744964 CCTTCTCACTCTTCTCTCTTCTT No data
Right 916341775 1:163744956-163744978 TCTCTTCTTTTTACAGGCAGAGG No data
916341770_916341775 12 Left 916341770 1:163744921-163744943 CCTCAAACCTGAGACCAAAATCC No data
Right 916341775 1:163744956-163744978 TCTCTTCTTTTTACAGGCAGAGG No data
916341769_916341775 13 Left 916341769 1:163744920-163744942 CCCTCAAACCTGAGACCAAAATC No data
Right 916341775 1:163744956-163744978 TCTCTTCTTTTTACAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916341775 Original CRISPR TCTCTTCTTTTTACAGGCAG AGG Intergenic
No off target data available for this crispr