ID: 916341814

View in Genome Browser
Species Human (GRCh38)
Location 1:163745133-163745155
Sequence CAGCATTTACAGACTGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916341814_916341818 12 Left 916341814 1:163745133-163745155 CCAGGGCCAGTCTGTAAATGCTG No data
Right 916341818 1:163745168-163745190 AGCCTGGACTCAGTGACCCCAGG No data
916341814_916341820 23 Left 916341814 1:163745133-163745155 CCAGGGCCAGTCTGTAAATGCTG No data
Right 916341820 1:163745179-163745201 AGTGACCCCAGGAATCTGCTTGG No data
916341814_916341816 -4 Left 916341814 1:163745133-163745155 CCAGGGCCAGTCTGTAAATGCTG No data
Right 916341816 1:163745152-163745174 GCTGTCTAATATCCTAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916341814 Original CRISPR CAGCATTTACAGACTGGCCC TGG (reversed) Intergenic
No off target data available for this crispr