ID: 916342228

View in Genome Browser
Species Human (GRCh38)
Location 1:163749377-163749399
Sequence GACACTGATGTATACACATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916342227_916342228 -3 Left 916342227 1:163749357-163749379 CCTGTTGCTTTAAGTACAATGAC No data
Right 916342228 1:163749377-163749399 GACACTGATGTATACACATCAGG No data
916342225_916342228 8 Left 916342225 1:163749346-163749368 CCCTTAGCTCTCCTGTTGCTTTA No data
Right 916342228 1:163749377-163749399 GACACTGATGTATACACATCAGG No data
916342226_916342228 7 Left 916342226 1:163749347-163749369 CCTTAGCTCTCCTGTTGCTTTAA No data
Right 916342228 1:163749377-163749399 GACACTGATGTATACACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916342228 Original CRISPR GACACTGATGTATACACATC AGG Intergenic
No off target data available for this crispr