ID: 916344180

View in Genome Browser
Species Human (GRCh38)
Location 1:163769655-163769677
Sequence GGCCAAAGTAGTCCTGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916344180_916344185 22 Left 916344180 1:163769655-163769677 CCTTGTCCAGGACTACTTTGGCC 0: 1
1: 0
2: 1
3: 12
4: 138
Right 916344185 1:163769700-163769722 TAAGATAACAAAAGCTGCACAGG No data
916344180_916344186 27 Left 916344180 1:163769655-163769677 CCTTGTCCAGGACTACTTTGGCC 0: 1
1: 0
2: 1
3: 12
4: 138
Right 916344186 1:163769705-163769727 TAACAAAAGCTGCACAGGCAAGG No data
916344180_916344187 28 Left 916344180 1:163769655-163769677 CCTTGTCCAGGACTACTTTGGCC 0: 1
1: 0
2: 1
3: 12
4: 138
Right 916344187 1:163769706-163769728 AACAAAAGCTGCACAGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916344180 Original CRISPR GGCCAAAGTAGTCCTGGACA AGG (reversed) Intergenic
901318335 1:8323926-8323948 GGCAAAATTAGCCCTGGAAATGG + Intronic
901705408 1:11069456-11069478 GGCCAAGTGAGTCCTGCACAAGG - Intronic
905474223 1:38214437-38214459 GGCTGAAGAAGTCCTGGAGACGG - Intergenic
916134514 1:161639606-161639628 GACCAAAGGAGTCCTGGTCTGGG - Intronic
916344180 1:163769655-163769677 GGCCAAAGTAGTCCTGGACAAGG - Intergenic
917087614 1:171319395-171319417 GGCCAGAGTGGTCTTGGAAAAGG + Intronic
920167469 1:204045868-204045890 GGCCACAGGACTCCTGGCCACGG - Intergenic
923975567 1:239258013-239258035 GGCCAGAGTGGTCTTGGAAAAGG + Intergenic
924597564 1:245460808-245460830 GGCCAAAATAACTCTGGACAGGG - Intronic
1063493391 10:6485652-6485674 GGCCAAATTTGCCCTGGACTCGG + Intronic
1066435178 10:35391165-35391187 GGCCAGAGCACACCTGGACAGGG + Intronic
1067697612 10:48547358-48547380 GGCAATAGGAGGCCTGGACAGGG - Intronic
1071104238 10:82076093-82076115 GGCCAATGGAGTACTGGATATGG + Intronic
1071347211 10:84704161-84704183 GGCCAAAGTAGTCATACACCTGG - Intergenic
1073735029 10:106336029-106336051 GGCCAAAGTGGTCTTGGAAAGGG - Intergenic
1075480806 10:122780221-122780243 GGCCAAAGTGGGCCTCGCCAGGG - Intergenic
1076225391 10:128770635-128770657 GGCCAGAGTAAGCCAGGACATGG + Intergenic
1078298449 11:10100416-10100438 GGCCACAGTTGTCTTGGACTGGG + Intronic
1081532343 11:43970800-43970822 GGCTTAAGTTGTCCTGGACTCGG + Intergenic
1082001354 11:47395162-47395184 GGCCAAAGTAGGCCTGGCCCTGG - Intergenic
1083426347 11:62589036-62589058 GGCCAGTGTTGTCATGGACAAGG - Exonic
1087723424 11:101692532-101692554 AGCCAAAGTTGTACAGGACAGGG - Intronic
1089361834 11:117895329-117895351 GGCTAAAGCAGTTTTGGACAAGG + Intergenic
1094672023 12:32579703-32579725 GGCCAAAGTTGTCCTCCTCAAGG + Intronic
1096466435 12:51849338-51849360 GGCCAAGGCAGTCCTGGGAAAGG - Intergenic
1097634109 12:62101369-62101391 GTCCAAATTCGTACTGGACATGG - Intronic
1098757736 12:74387492-74387514 GGCCAGAGTGGTCTTGGAAAAGG + Intergenic
1098758365 12:74391883-74391905 GGCCAGAGTGGTCTTGGAAAAGG + Intergenic
1098827108 12:75310329-75310351 GGCCAAAGTAGGCCTCACCAAGG + Intronic
1099475644 12:83104620-83104642 GGGCAATGGAGTCCTGGGCAAGG + Intronic
1101249961 12:102923305-102923327 GACTAAAGCAGTTCTGGACAGGG + Intronic
1106055290 13:26231416-26231438 AGCCAAAGTGTTACTGGACATGG - Intergenic
1108159023 13:47618687-47618709 GGCCAGAGTGGTCTTGGAAAAGG - Intergenic
1109909070 13:68886326-68886348 TGCCAAAGTACTCATGGTCAAGG + Intergenic
1110296873 13:73877911-73877933 GGCCAGAGTAGTCTTGGAAAAGG - Intronic
1110385627 13:74907117-74907139 GGCCAGAGTGGTCTTGGAAAAGG + Intergenic
1111136244 13:84048295-84048317 AACAAAAGTAATCCTGGACATGG - Intergenic
1111251946 13:85613114-85613136 GGTCAGAGTAGTCTTGGAAAAGG + Intergenic
1112259736 13:97867483-97867505 GGCCAGAGTGGTCTTGGAAAAGG - Intergenic
1113573312 13:111374161-111374183 GGCCAAAGTGAGCCTGGACCAGG - Intergenic
1120614633 14:86688521-86688543 GGCCAGAGTGGTCTTGGAAAAGG - Intergenic
1121456677 14:94042978-94043000 GGACAAACTAGTCCTGGCCCAGG + Intronic
1126965117 15:54043172-54043194 GGCTAAAATAATTCTGGACATGG + Intronic
1127530017 15:59834617-59834639 GGCCAAAGTATTTATGGTCAGGG + Intergenic
1133005693 16:2880365-2880387 GGCCAAGGGAGGCCTGAACAGGG + Intergenic
1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG + Intronic
1134598436 16:15514380-15514402 GGGCAAAGTGGTCGTGGTCAGGG + Intronic
1134876364 16:17702584-17702606 GATCAAAGAAGTCCTGGAGATGG + Intergenic
1138858519 16:60725637-60725659 GCCCAGAGTAGTCATGTACATGG + Intergenic
1140564564 16:76026772-76026794 GGCCACAGTAGTTTTGGAAAAGG - Intergenic
1143595092 17:7909316-7909338 GGCCAACGCCGTCCTGCACAAGG + Exonic
1143783015 17:9239366-9239388 GGACAAAGTGGGCCTTGACAAGG + Intronic
1144579265 17:16448996-16449018 AGCCAAACTCGTGCTGGACAGGG + Intronic
1146824001 17:36007961-36007983 GGCCAGAGTAGTCTTGGAAAAGG - Intergenic
1146824631 17:36011977-36011999 GGCCAGAGTGGTCTTGGAAAAGG - Intergenic
1147181813 17:38691252-38691274 GGCCAGAGGAGACCTGGAAAAGG + Intergenic
1151361257 17:73590506-73590528 GGCCTAAGTAGTCTTTAACAGGG + Intronic
1152463307 17:80452385-80452407 GGCCACAGATGTCCTGGCCATGG + Intergenic
1159963346 18:74572914-74572936 GGCCTCAGTAGTCCAGGCCATGG + Intronic
1162324938 19:9993421-9993443 GGCCAAAGTCACCCTGGAGAGGG + Exonic
1164502427 19:28831270-28831292 GGCCCAGGGAGTCCTGGCCAGGG + Intergenic
1165131397 19:33634747-33634769 GCCCAGAATAGTCCTGCACAGGG + Intronic
1167173399 19:47848851-47848873 TGCTAAATTAGTCCTGGTCAGGG - Intergenic
1168338073 19:55607733-55607755 GGCCACAGTTGTCCAGGAGAAGG - Intronic
927920579 2:26969500-26969522 GGGCAGAGCAGTGCTGGACAAGG + Intergenic
927933119 2:27058414-27058436 GGCCATTGCAGCCCTGGACATGG + Exonic
931031758 2:58183822-58183844 AGCCAACGTAGTCCTGTACATGG - Intronic
933425917 2:82112319-82112341 GGCCAAAGTGATCTTGGAAAAGG - Intergenic
936907422 2:117553307-117553329 GACCAAAGTAGGCCTGTACAAGG - Intergenic
938770763 2:134498897-134498919 GGCCAAGATAGTCCTGGACGAGG + Intronic
939130017 2:138223940-138223962 AGCAAATGTATTCCTGGACATGG - Intergenic
939245058 2:139612947-139612969 GGTCAGAGTGGTCTTGGACAAGG - Intergenic
939356944 2:141114635-141114657 GGTCAGAGTAGTCTTGGAAAAGG + Intronic
942293929 2:174499533-174499555 GGCCCAGGCAGTCCTGGGCAGGG - Intergenic
942798096 2:179844916-179844938 GGATAAATAAGTCCTGGACATGG - Intronic
943005226 2:182381025-182381047 AGCCAAAGCAGTGATGGACATGG + Intronic
946319574 2:218944041-218944063 GGTCAAAGAAGTCATGGAAAGGG + Intergenic
947237618 2:227959380-227959402 TGCCAAAGGAGTGCTGGACTTGG - Intergenic
947816285 2:233039833-233039855 GACCAGAGTAGTCCCGGACAAGG - Intergenic
1172062579 20:32196625-32196647 GGCCACAGGAGGCCTGGTCATGG - Exonic
1173509223 20:43613004-43613026 GGGCAATGTACTCCTGGAGAGGG - Intronic
1174565495 20:51461672-51461694 CGCCCAAGTAGGCCTGGAAATGG + Intronic
1174997784 20:55590081-55590103 GGCCAGAGTGGTCTTGGAAAAGG + Intergenic
1175842965 20:62042101-62042123 GGCCAGATTAGTCTTGGAAAAGG - Intronic
1178557259 21:33603610-33603632 GGCCATAGTAGTACTAGAGATGG - Intronic
1178919326 21:36728414-36728436 GCCTAAAGGAGGCCTGGACAGGG + Intronic
1179040833 21:37801046-37801068 GGTCAAAGTTGTCCTAAACAAGG - Intronic
1182422432 22:30254913-30254935 GGCCAAGGTGGGCCTGGACCTGG - Intergenic
1184549752 22:45198160-45198182 GGCCAAAGTCTTCCTGGAGTTGG - Intronic
951899431 3:27642258-27642280 GGCTATAGTAGTCCTGGTGACGG + Intergenic
953187182 3:40649024-40649046 TTCCAAAGAAGTCCTAGACATGG + Intergenic
954215613 3:49122785-49122807 GGCCCAGGCAGCCCTGGACAAGG - Exonic
955260452 3:57384255-57384277 GGCCAAAGTGGTTCTGTACATGG - Intronic
957015371 3:75057097-75057119 GTCCAAAGTAGTCTTGGGCTAGG + Intergenic
958762369 3:98324927-98324949 GGGTAAAGGAGTCCTGGGCAAGG + Intergenic
959115902 3:102177850-102177872 GGGTAAAGGAGTCCTGGGCAAGG - Intronic
959855810 3:111156567-111156589 GGGCAAAGTAGTCATGACCACGG + Intronic
960169823 3:114446859-114446881 GGCCAAAGTAGAACTGGTCTTGG - Intronic
960697346 3:120409160-120409182 GGCCAAAGTGGTCCAGGTCTGGG + Intronic
963114377 3:141713905-141713927 GGACTCAGTAGGCCTGGACAGGG - Intergenic
965849690 3:173009408-173009430 GGCCTTTGTAGTCCTGGCCATGG + Intronic
967052447 3:185797360-185797382 GGCCAAAAGAGTACCGGACATGG - Intronic
967774890 3:193376088-193376110 GGTCAAAGTAAACCTGGGCATGG - Intronic
968599993 4:1504249-1504271 GGCCACAGGAGGCCTGGACCTGG + Intergenic
969248704 4:5953424-5953446 GGCCAGGTTAGTACTGGACAAGG - Intronic
970943292 4:21660976-21660998 GGCCAGAGTGGTCTTGGAAAAGG - Intronic
973970673 4:56211331-56211353 GGCCAAGCTAGGCCTGGGCAGGG - Intronic
979846699 4:125522717-125522739 GGCCAGAGTGGTCTTGGAAAAGG - Intergenic
980567002 4:134555470-134555492 GGTCCAAGTTGTCCTGGAGAGGG + Intergenic
981902936 4:149888121-149888143 AGACAAAGATGTCCTGGACAGGG - Intergenic
983679777 4:170339896-170339918 GGCCAAAGCACACCTGAACAAGG - Intergenic
986775168 5:11007645-11007667 GGGCAAAGGAGTCATGGACTTGG + Intronic
988935831 5:36082092-36082114 GGCCTAAGTACTCCTGCAAATGG + Intergenic
989090986 5:37731080-37731102 GGTCAGAGTTGTCCTGGTCAGGG + Intronic
989558559 5:42825380-42825402 GGCCAGGGTGGTCCTGGAAAAGG - Intronic
990848129 5:60168025-60168047 GGCCACAGTAGTCTTGGACAGGG - Intronic
993094559 5:83466162-83466184 GGCCAAAGGAGTTGTGGAAATGG + Intergenic
993625729 5:90222645-90222667 GGACATAGGAGTCCAGGACAGGG + Intergenic
999448362 5:151659416-151659438 ATGCAAAGGAGTCCTGGACAGGG - Intergenic
1001962650 5:175889365-175889387 GGCCTAAGTAGTTCTGGATTGGG + Intergenic
1003946029 6:11076776-11076798 GGCTAATGAAGTCCTGGGCAAGG - Intergenic
1006826605 6:36940444-36940466 GGCAAAAGGAGTCTTGGAAAGGG + Intergenic
1009404131 6:63291612-63291634 GGCCAGAGTGGTCTTGGAAAAGG + Intronic
1010556193 6:77282181-77282203 GGCCATAGTAGTTTTGGAAAAGG + Intergenic
1011659878 6:89585384-89585406 CCCCAAAGAAGTCCTAGACATGG + Intronic
1013045886 6:106484632-106484654 AGCCAAAGTAATCCTGAGCAAGG - Intergenic
1014474802 6:121859234-121859256 GGCCACAGTGAGCCTGGACAAGG - Intergenic
1015042833 6:128742607-128742629 GGCCAGAGTGGTCTTGGAAAAGG - Intergenic
1016076410 6:139801817-139801839 GGCAAAGGTAATTCTGGACAGGG - Intergenic
1017925384 6:158907789-158907811 GGCTAAAGGAGTCCTTGGCAAGG + Intronic
1018198980 6:161378276-161378298 GGCCACAGCAGTCCTGGGCCAGG + Intronic
1020208548 7:6139728-6139750 GGACAATGAAGTCCTAGACAGGG - Intronic
1027217872 7:76195692-76195714 GGGGAAACTAGTGCTGGACAGGG + Intergenic
1027706107 7:81535661-81535683 GGCCAGAGTGGTCTTGGAAAAGG - Intergenic
1031809484 7:126347829-126347851 GGTCAAAGCAGTTCTGGGCAAGG + Intergenic
1033328751 7:140400603-140400625 TGCCAAAAAAGTCCTGGAGATGG + Intronic
1033767059 7:144505626-144505648 GGCCAGAGTGGTCTTGGAAAAGG - Intronic
1038381068 8:27095067-27095089 GGGTAAAGGAGTCCTGGGCAAGG + Intergenic
1040105904 8:43541813-43541835 GGGCAAAGAAGTCCTGGAGCAGG + Intergenic
1046988175 8:120414825-120414847 GGGGAAAGTGGTCCTGGTCAGGG - Intronic
1049943560 9:572684-572706 AGCAAAAGTAGGGCTGGACATGG - Intronic
1053046036 9:34918041-34918063 TCCCAAAGGAGGCCTGGACAAGG + Intergenic
1055281299 9:74677292-74677314 GCCCAAAGTAGTGCTGGCCACGG - Intronic
1056949604 9:91031647-91031669 AGCCAAAGGACTCCTGGAAAGGG - Intergenic
1059095899 9:111414459-111414481 GGCCAATGTAGATCTGGACAGGG + Exonic
1059530740 9:115033186-115033208 GGAGAAAAGAGTCCTGGACAGGG - Intronic
1203453308 Un_GL000219v1:141369-141391 GGCCAAGGCAGCCCTGGACCAGG - Intergenic
1187279967 X:17850664-17850686 GGCCCAAGTAGACCTGGAAGGGG - Intronic
1189207773 X:39256733-39256755 GCCCAAAGTAGACCTGAAGAGGG + Intergenic
1189845311 X:45131206-45131228 GGCCTAAGGAATCCTGAACAGGG + Intergenic
1198058496 X:133019660-133019682 GGCTAAATTATTCCAGGACAAGG + Intergenic
1200042323 X:153379384-153379406 GGCCAAGGTAGGCGGGGACAAGG + Intergenic