ID: 916346271

View in Genome Browser
Species Human (GRCh38)
Location 1:163795077-163795099
Sequence CATAGTAAAGTGCTTATAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916346271_916346274 21 Left 916346271 1:163795077-163795099 CCCATTATAAGCACTTTACTATG No data
Right 916346274 1:163795121-163795143 GGCTTAAATCATTTGCTCTGAGG No data
916346271_916346273 0 Left 916346271 1:163795077-163795099 CCCATTATAAGCACTTTACTATG No data
Right 916346273 1:163795100-163795122 CTGCAGACTAATTTTTACTGTGG No data
916346271_916346275 22 Left 916346271 1:163795077-163795099 CCCATTATAAGCACTTTACTATG No data
Right 916346275 1:163795122-163795144 GCTTAAATCATTTGCTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916346271 Original CRISPR CATAGTAAAGTGCTTATAAT GGG (reversed) Intergenic
No off target data available for this crispr