ID: 916346412

View in Genome Browser
Species Human (GRCh38)
Location 1:163796812-163796834
Sequence GCCTTCTTACCAATCAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916346412_916346416 -5 Left 916346412 1:163796812-163796834 CCAACCCTGATTGGTAAGAAGGC No data
Right 916346416 1:163796830-163796852 AAGGCTGGAAGAAACACCTGTGG No data
916346412_916346418 6 Left 916346412 1:163796812-163796834 CCAACCCTGATTGGTAAGAAGGC No data
Right 916346418 1:163796841-163796863 AAACACCTGTGGCATGCAATGGG No data
916346412_916346420 17 Left 916346412 1:163796812-163796834 CCAACCCTGATTGGTAAGAAGGC No data
Right 916346420 1:163796852-163796874 GCATGCAATGGGATGCTCTGAGG No data
916346412_916346417 5 Left 916346412 1:163796812-163796834 CCAACCCTGATTGGTAAGAAGGC No data
Right 916346417 1:163796840-163796862 GAAACACCTGTGGCATGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916346412 Original CRISPR GCCTTCTTACCAATCAGGGT TGG (reversed) Intergenic
No off target data available for this crispr