ID: 916346414

View in Genome Browser
Species Human (GRCh38)
Location 1:163796816-163796838
Sequence TCCAGCCTTCTTACCAATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916346414_916346416 -9 Left 916346414 1:163796816-163796838 CCCTGATTGGTAAGAAGGCTGGA No data
Right 916346416 1:163796830-163796852 AAGGCTGGAAGAAACACCTGTGG No data
916346414_916346418 2 Left 916346414 1:163796816-163796838 CCCTGATTGGTAAGAAGGCTGGA No data
Right 916346418 1:163796841-163796863 AAACACCTGTGGCATGCAATGGG No data
916346414_916346417 1 Left 916346414 1:163796816-163796838 CCCTGATTGGTAAGAAGGCTGGA No data
Right 916346417 1:163796840-163796862 GAAACACCTGTGGCATGCAATGG No data
916346414_916346420 13 Left 916346414 1:163796816-163796838 CCCTGATTGGTAAGAAGGCTGGA No data
Right 916346420 1:163796852-163796874 GCATGCAATGGGATGCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916346414 Original CRISPR TCCAGCCTTCTTACCAATCA GGG (reversed) Intergenic
No off target data available for this crispr