ID: 916346417

View in Genome Browser
Species Human (GRCh38)
Location 1:163796840-163796862
Sequence GAAACACCTGTGGCATGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916346414_916346417 1 Left 916346414 1:163796816-163796838 CCCTGATTGGTAAGAAGGCTGGA No data
Right 916346417 1:163796840-163796862 GAAACACCTGTGGCATGCAATGG No data
916346412_916346417 5 Left 916346412 1:163796812-163796834 CCAACCCTGATTGGTAAGAAGGC No data
Right 916346417 1:163796840-163796862 GAAACACCTGTGGCATGCAATGG No data
916346415_916346417 0 Left 916346415 1:163796817-163796839 CCTGATTGGTAAGAAGGCTGGAA No data
Right 916346417 1:163796840-163796862 GAAACACCTGTGGCATGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916346417 Original CRISPR GAAACACCTGTGGCATGCAA TGG Intergenic
No off target data available for this crispr