ID: 916349552

View in Genome Browser
Species Human (GRCh38)
Location 1:163833656-163833678
Sequence ATGCAATTCCACCACGGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916349548_916349552 -9 Left 916349548 1:163833642-163833664 CCTCATTGCATCCCATGCAATTC No data
Right 916349552 1:163833656-163833678 ATGCAATTCCACCACGGCTAAGG No data
916349547_916349552 -4 Left 916349547 1:163833637-163833659 CCTTTCCTCATTGCATCCCATGC No data
Right 916349552 1:163833656-163833678 ATGCAATTCCACCACGGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916349552 Original CRISPR ATGCAATTCCACCACGGCTA AGG Intergenic
No off target data available for this crispr