ID: 916360137

View in Genome Browser
Species Human (GRCh38)
Location 1:163958999-163959021
Sequence TGGGATTCTGCAGATGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916360134_916360137 -5 Left 916360134 1:163958981-163959003 CCAGGCAATTTTTCTATTTGGGA No data
Right 916360137 1:163958999-163959021 TGGGATTCTGCAGATGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916360137 Original CRISPR TGGGATTCTGCAGATGGGCA AGG Intergenic
No off target data available for this crispr