ID: 916360464

View in Genome Browser
Species Human (GRCh38)
Location 1:163962080-163962102
Sequence CACACTATGTGGCCACTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916360464_916360467 3 Left 916360464 1:163962080-163962102 CCTGGGAGTGGCCACATAGTGTG No data
Right 916360467 1:163962106-163962128 AGAATCTGTACACTTCAGAAAGG No data
916360464_916360469 22 Left 916360464 1:163962080-163962102 CCTGGGAGTGGCCACATAGTGTG No data
Right 916360469 1:163962125-163962147 AAGGGACAGCACAGTTATTGTGG No data
916360464_916360470 23 Left 916360464 1:163962080-163962102 CCTGGGAGTGGCCACATAGTGTG No data
Right 916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG No data
916360464_916360468 4 Left 916360464 1:163962080-163962102 CCTGGGAGTGGCCACATAGTGTG No data
Right 916360468 1:163962107-163962129 GAATCTGTACACTTCAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916360464 Original CRISPR CACACTATGTGGCCACTCCC AGG (reversed) Intergenic
No off target data available for this crispr