ID: 916360466

View in Genome Browser
Species Human (GRCh38)
Location 1:163962091-163962113
Sequence CAGATTCTCTCCACACTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916360466_916360471 23 Left 916360466 1:163962091-163962113 CCACATAGTGTGGAGAGAATCTG No data
Right 916360471 1:163962137-163962159 AGTTATTGTGGGATTTGTACTGG No data
916360466_916360470 12 Left 916360466 1:163962091-163962113 CCACATAGTGTGGAGAGAATCTG No data
Right 916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG No data
916360466_916360468 -7 Left 916360466 1:163962091-163962113 CCACATAGTGTGGAGAGAATCTG No data
Right 916360468 1:163962107-163962129 GAATCTGTACACTTCAGAAAGGG No data
916360466_916360467 -8 Left 916360466 1:163962091-163962113 CCACATAGTGTGGAGAGAATCTG No data
Right 916360467 1:163962106-163962128 AGAATCTGTACACTTCAGAAAGG No data
916360466_916360469 11 Left 916360466 1:163962091-163962113 CCACATAGTGTGGAGAGAATCTG No data
Right 916360469 1:163962125-163962147 AAGGGACAGCACAGTTATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916360466 Original CRISPR CAGATTCTCTCCACACTATG TGG (reversed) Intergenic
No off target data available for this crispr