ID: 916360470

View in Genome Browser
Species Human (GRCh38)
Location 1:163962126-163962148
Sequence AGGGACAGCACAGTTATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916360466_916360470 12 Left 916360466 1:163962091-163962113 CCACATAGTGTGGAGAGAATCTG No data
Right 916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG No data
916360464_916360470 23 Left 916360464 1:163962080-163962102 CCTGGGAGTGGCCACATAGTGTG No data
Right 916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916360470 Original CRISPR AGGGACAGCACAGTTATTGT GGG Intergenic
No off target data available for this crispr