ID: 916361986

View in Genome Browser
Species Human (GRCh38)
Location 1:163980612-163980634
Sequence GTGGTTTTTCCAGGAAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916361986_916361991 18 Left 916361986 1:163980612-163980634 CCTTTCTTTCCTGGAAAAACCAC No data
Right 916361991 1:163980653-163980675 GCAGCAAGATGGATAATAAAAGG No data
916361986_916361990 7 Left 916361986 1:163980612-163980634 CCTTTCTTTCCTGGAAAAACCAC No data
Right 916361990 1:163980642-163980664 ATGTTTCATCAGCAGCAAGATGG No data
916361986_916361992 19 Left 916361986 1:163980612-163980634 CCTTTCTTTCCTGGAAAAACCAC No data
Right 916361992 1:163980654-163980676 CAGCAAGATGGATAATAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916361986 Original CRISPR GTGGTTTTTCCAGGAAAGAA AGG (reversed) Intergenic
No off target data available for this crispr