ID: 916361988

View in Genome Browser
Species Human (GRCh38)
Location 1:163980621-163980643
Sequence ATCACTCCTGTGGTTTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916361988_916361990 -2 Left 916361988 1:163980621-163980643 CCTGGAAAAACCACAGGAGTGAT No data
Right 916361990 1:163980642-163980664 ATGTTTCATCAGCAGCAAGATGG No data
916361988_916361992 10 Left 916361988 1:163980621-163980643 CCTGGAAAAACCACAGGAGTGAT No data
Right 916361992 1:163980654-163980676 CAGCAAGATGGATAATAAAAGGG No data
916361988_916361991 9 Left 916361988 1:163980621-163980643 CCTGGAAAAACCACAGGAGTGAT No data
Right 916361991 1:163980653-163980675 GCAGCAAGATGGATAATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916361988 Original CRISPR ATCACTCCTGTGGTTTTTCC AGG (reversed) Intergenic
No off target data available for this crispr